Re^2: Create the reverse complement DNA sequence without pattern matching and reverse built-in function?

Another similar approach, for illustration purposes:

perl -Mstrict -Mwarnings -le 'my 
$seq=q{ACGGGAGGACGGGAAAATTACTACGGCATTAGC}; my $complement; 
my %rc = ( A => q{T}, T => q{A}, C => q{G}, G => q{C}, ); 
my @letters = split //, $seq; while ( @letters ) { 
my $l = uc pop @letters; $complement .= $rc{$l}; } 
print $seq; print $complement;'
[download]

Hope that helps.

Comment on Re^2: Create the reverse complement DNA sequence without pattern matching and reverse built-in function? Download Code