Attempting to automate a series of queries to an HIV research tool ("http://www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html"; within scope of acceptable use, BTW).

Although I can read the page into a WWW::Mechanize object, and define the file I need to upload, there are two buttons on the page -- I need to click the second one ("Run") and am unable to access it through find_all_submits() or find_all_inputs(): only the first shows up! E.g., via find_all_submits() in the perl debugger:

x $mechanize->find_all_submits()
0  HTML::Form::SubmitInput=HASH(0x7f9fab008238)
   '/' => '/'
   'class' => 'button'
   'name' => 'btnG'
   'onmouseout' => 'this.style.background=\'#e3e3e3\';'
   'onmouseover' => 'this.style.background=\'#f3600a\';'
   'style' => '{width: 80px; font-size: 9pt;}'
   'type' => 'submit'
   'value' => 'Search Site'
   'value_name' => ''
[download]

Nevertheless, after I save the object to a file, mech-dump shows both the first submit button,"btnG," and the second one ("submit=Run (submit)" -- the one I need):

% mech-dump /tmp/hypermut.html 
GET http://searcher-green.lanl.gov/search
  q=                             (text)
  btnG=Search Site               (submit)
  client=outside_lanl            (hidden readonly)
  ...
  site=HIV                       (hidden readonly)

POST file:///cgi-bin/HYPERMUT/hypermut.cgi (multipart/form-data)
  FORMAT=FASTA                   (option)   [IG (IntelliGenetics)|MSF|
+GDE|*FASTA|PHYLIP (Interleaved)|PHYLIP (Sequential)|SLX|TABLE]
  ALIGNMENT=                     (textarea)
  upfile1=                       (file)
  ...
  ...
  submit=Run                     (submit)
  <NONAME>=<UNDEF>               (reset)
[download]

$mechanize->submit() hits the first (search) button -- not what I need. I suspect the problem has something to do with the two sets of fields that mech-dump returns (GET vs. POST): what do these mean? I can define upload1 just fine, but how can I hit the "Run" button afterwards?

Minimal working example:

#!/usr/bin/perl
use warnings;
use strict;
use WWW::Mechanize;
use File::Temp qw/tempfile/;

my $url = "http://www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.
+html";
my $mechanize = WWW::Mechanize->new( autocheck => 1 );

$mechanize->get($url);

my $seqfile = make_test_seqfile();
$mechanize->field( 'upfile1', $seqfile );

my $page = $mechanize->content;
# save the page locally
open my $FH, ">/tmp/hypermut.html";
print {$FH} $page;
close $FH;
warn "saved webpage data to /tmp/hypermut.html\n";

sub make_test_seqfile {
    my $testfile = File::Temp->new( UNLINK => 1, SUFFIX => '.fasta' )
      or die "File::Temp: $!\n";
    warn "opened $testfile";
    print {$testfile} << 'END_TESTSEQS';
>HIV1-test.CONS
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.1
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.2
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.3
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.4
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.5
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
END_TESTSEQS
    close $testfile;
    return($testfile . '');
}
[download]