Re^3: www::mechanize: second "submit" invisible to find_all

This excellent suggestion is a good start, but it doesn't get me there. I've altered the code to fit my current understanding, but my $mech object, even after the post, still represents the initial page, not the results page.

I'm encouraged that I can in fact retrieve the initial page, but discouraged not to be able to get to the results (whether I upload the sequences as a file via the 'upfile1' attribute, or, as below, include them as a text field). Here's what I have:

#!/usr/bin/perl
use warnings;
use strict;
use WWW::Mechanize;

my $hypermutUrl =
  "http://www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html";
my $mech = WWW::Mechanize->new( autocheck => 1 );

my $alignment_as_string = <<'END_SEQS';
>HIV1-test.CONS
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.1
ATGGAATGTCTTGGAAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC
>HIV1-test.2
ATGGAATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC
END_SEQS

$mech->post(
    $hypermutUrl,
    'FORMAT'            => 'FASTA',
    'ALIGNMENT'         => $alignment_as_string,
    'upfile1'           => '',
    'INN'               => '',
    'OUT'               => '',
    'MUTUPSTREAM'       => '',
    'MUTFROM'           => 'G',
    'MUTTO'             => 'A',
    'MUTDOWNSTREAM'     => 'RD',
    'ENFORCE'           => 'DESCENDANT',
    'CONTROLUPSTREAM'   => '',
    'CONTROLFROM'       => 'G',
    'CONTROLTO'         => 'A',
    'CONTROLDOWNSTREAM' => 'YN|RC',
    'Analysis'          => 'All',
    'submit'            => 'Run',
);

my $page = $mech->content;
open my $FH, ">/tmp/hypermut.html";
print {$FH} $page; close $FH;
warn "saved webpage data to /tmp/hypermut.html\n";
[download]

I would expect the post operation to add the page resulting from that post to my $mech object -- where am I going wrong?

Comment on Re^3: www::mechanize: second "submit" invisible to find_all_submits Download Code

Replies are listed 'Best First'.
Re^4: www::mechanize: second "submit" invisible to find_all_submits by Anonymous Monk on Dec 09, 2014 at 00:47 UTC
... encouraged ... discouraged ... Remember www::mechanize: second "submit" invisible to find_all_submits? What is action? You're knocking a the wrong door, the door you want is ...hypermut.cgi Additional html related wisdom at markup validation	[reply]
Re^5: www::mechanize: second "submit" invisible to find_all_submits by wfischer (Novice) on Dec 09, 2014 at 17:31 UTC
Correct, thanks -- using the cgi url (not coincidentally, mech-dump shows it in the POST list) gets an appropriate page back. Unfortunately, it says "Sorry! no sequence input." So I'm still not getting the sequences uploaded -- I'll update if I do get it to go.	[reply]
Re^6: www::mechanize: second "submit" invisible to find_all_submits by wfischer (Novice) on Dec 22, 2014 at 21:39 UTC
The final key here was that the second argument to the post method needed to be an array ref (i.e., the hash arguments needed to be enclosed in []s). The code below works, returning the desired output page in the $mech object. #!/usr/bin/perl use warnings; use strict; use WWW::Mechanize; my $hypermutUrl = "http://http://hiv-dev.lanl.gov/cgi-bin/HYPERMUT/hypermut.cgi"; my $mech = WWW::Mechanize->new( autocheck => 1 ); my $alignment_as_string = <<'END_SEQS'; >HIV1-test.CONS ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC >HIV1-test.1 ATGGAATGTCTTGGAAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC >HIV1-test.2 ATGGAATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC END_SEQS $mech->post( $hypermutUrl, [ 'FORMAT' => 'FASTA', 'ALIGNMENT' => $alignment_as_string, 'upfile1' => '', 'INN' => '', 'OUT' => '', 'MUTUPSTREAM' => '', 'MUTFROM' => 'G', 'MUTTO' => 'A', 'MUTDOWNSTREAM' => 'RD', 'ENFORCE' => 'DESCENDANT', 'CONTROLUPSTREAM' => '', 'CONTROLFROM' => 'G', 'CONTROLTO' => 'A', 'CONTROLDOWNSTREAM' => 'YN\|RC', 'Analysis' => 'All', 'submit' => 'Run', ] ); my $page = $mech->content; open my $FH, ">/tmp/hypermut.html"; print {$FH} $page; close $FH; warn "saved webpage data to /tmp/hypermut.html\n"; [download] Thanks to any and all who thought about it, and most particularly to my colleague who found my error.	[reply] [d/l]
Re^6: www::mechanize: second "submit" invisible to find_all_submits by Anonymous Monk on Dec 09, 2014 at 18:11 UTC
Does it work for you from the browser? You can http://WireShark.org or LiveHTTPHeaders to figure out what works from the browser ... but it is fairly raw http	[reply]