in reply to Re^3: Alignment and matrix generation
in thread Alignment and matrix generation
Dear Choroba
Thank you for your time. I modified the code as per your suggestions but it seems that the code is skipping the first block of alignment and rest the occurrences of nucleotides as percentages are wrong.
I am attaching the code and the data file for the same
#!/usr/bin/perl use strict; use warnings; use Syntax::Construct qw{ // }; my $endpos = 0; my ($startpos, $count); my %occurrences; my $file = $ARGV[0]; open(DATA, $file); while (<DATA>) { if (/^CLUSTAL.*/) {next;} if (/^ +$/) { $startpos = $endpos + 1; $count = 0; } elsif (/\s+ ([-actg]+) \s*$/x) { ++$count; my @nucleotides = split //, $1; $endpos = $endpos + length $1 if $startpos == $endpos + 1; for my $pos (0 .. $#nucleotides) { ++$occurrences{ $nucleotides[$pos] }[$startpos + $pos] unless '-' eq $nucleotides[$pos]; } } } for my $pos (1 .. $endpos) { print "$pos\t"; for my $nucleotide (sort keys %occurrences) { printf "%s\t%0.1f\t", uc $nucleotide, 100 * ($occurrences{$nuc +leotide}[$pos] // 0) / $count; } print "\n"; }
Data file
CLUSTAL O(1.2.1) multiple sequence alignment gnl|hbvcds|AB014370_PreC_P-A ----------------------------------- +------------------------- gnl|hbvcds|AB064314_PreC_P-A ----------------------------------- +------------------------- gnl|hbvcds|AB014384_C_P-C ----------------------------------- +------------------------- gnl|hbvcds|AB014385_C_P-C ----------------------------------- +------------------------- gnl|hbvcds|AB048701_PreS1_P-D atggggcagaatctttccaccagcaatcctctggg +attctttcccgaccatcagttggat gnl|hbvcds|AB078031_PreS1_P-D atggggcagaatctttccaccagcaaccctctggg +attctttcccgaccaccagttggat gnl|hbvcds|AB030513_S_P-A ----------------------------------- +------------------------a gnl|hbvcds|AB064314_S_P-A ----------------------------------- +------------------------c gnl|hbvcds|AB194947_PreS2_P-E ----------------------------------- +------------------------g gnl|hbvcds|AB194948_PreS2_P-E ----------------------------------- +------------------------g + gnl|hbvcds|AB014370_PreC_P-A tagagtctcctgagcattgctcacctcaccatact +gcactcaggcaagccattctctgct gnl|hbvcds|AB064314_PreC_P-A tagagtctcctgagcattgctcacctcaccatacg +gcactcaggcaagccattctctgct gnl|hbvcds|AB014384_C_P-C tagagtctccggaacattgttcacctcaccataca +gcactcaggcaagctattctgtgtt gnl|hbvcds|AB014385_C_P-C tagagtctccggaacattgttcacctcaccataca +gcactcaggcaagctattctgtgtt gnl|hbvcds|AB048701_PreS1_P-D gggtttttcttgttgacaagaatcctcacaatacc +gcagagtctagactcgtggtggact gnl|hbvcds|AB078031_PreS1_P-D gggtttttcttgttgacaagaatcctcacaatacc +gcagagtctagactcgtggtggact gnl|hbvcds|AB030513_S_P-A gggtttttcttgttgacaagaatcctcacaatacc +gcagagtctagactcgtggtggact gnl|hbvcds|AB064314_S_P-A gggtttttcttgttgacaagaatcctcacaatacc +gcagagtctagactcgtggtggact gnl|hbvcds|AB194947_PreS2_P-E gggtttttcttgttgacaaaaatcctcacaatacc +gcagagtctagactcgtggtggact gnl|hbvcds|AB194948_PreS2_P-E gggtttttcttgttgacaaaaatcctcacaatacc +gcagagtctagactcgtggtggact * * ** * * ****** **** +*** * * * *
Regards
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re^5: Alignment and matrix generation
by choroba (Cardinal) on Mar 31, 2015 at 15:57 UTC | |
by newtoperlprog (Sexton) on Apr 01, 2015 at 14:12 UTC |