--- 1.pl        2015-03-30 22:58:28.434954333 +0200
+++ 2.pl        2015-03-30 22:58:11.261833250 +0200
@@ -3,16 +3,18 @@
 use warnings;
 use Syntax::Construct qw{ // };
 
-my ($startpos, $endpos, $count);
+my $endpos = 0;
+my ($startpos, $count);
 my %occurrences;
 while (<DATA>) {
-    if (/^\s+ ([0-9]+) \s+ ([0-9]+) \s*$/x) {
-        ($startpos, $endpos) = ($1, $2);
+    if (/^ +$/) {
+        $startpos = $endpos + 1;
         $count = 0;
 
     } elsif (/\s+ ([-actg]+) \s*$/x) {
         ++$count;
         my @nucleotides = split //, $1;
+        $endpos = $endpos + length $1 if $startpos == $endpos + 1;
         for my $pos (0 .. $#nucleotides) {
             ++$occurrences{ $nucleotides[$pos] }[$startpos + $pos]
                 unless '-' eq $nucleotides[$pos];
[download]

Dear Choroba

Thank you for your time. I modified the code as per your suggestions but it seems that the code is skipping the first block of alignment and rest the occurrences of nucleotides as percentages are wrong.

I am attaching the code and the data file for the same

#!/usr/bin/perl
use strict;
use warnings;
use Syntax::Construct qw{ // };

my $endpos = 0;
my ($startpos, $count);
my %occurrences;

my $file = $ARGV[0];
open(DATA, $file);
while (<DATA>) {
    if (/^CLUSTAL.*/) {next;}
    if (/^ +$/) {
    $startpos = $endpos + 1;
    $count = 0;
    }
    elsif (/\s+ ([-actg]+) \s*$/x) {
        ++$count;
        my @nucleotides = split //, $1;
    $endpos = $endpos + length $1 if $startpos == $endpos + 1;
        for my $pos (0 .. $#nucleotides) {
            ++$occurrences{ $nucleotides[$pos] }[$startpos + $pos]
                unless '-' eq $nucleotides[$pos];
        }
    }
}

for my $pos (1 .. $endpos) {
    print "$pos\t";
    for my $nucleotide (sort keys %occurrences) {
        printf "%s\t%0.1f\t", uc $nucleotide, 100 * ($occurrences{$nuc
+leotide}[$pos] // 0) / $count;
    }
    print "\n";
}
[download]

Data file

CLUSTAL O(1.2.1) multiple sequence alignment


gnl|hbvcds|AB014370_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB064314_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB014384_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB014385_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB048701_PreS1_P-D      atggggcagaatctttccaccagcaatcctctggg
+attctttcccgaccatcagttggat
gnl|hbvcds|AB078031_PreS1_P-D      atggggcagaatctttccaccagcaaccctctggg
+attctttcccgaccaccagttggat
gnl|hbvcds|AB030513_S_P-A          -----------------------------------
+------------------------a
gnl|hbvcds|AB064314_S_P-A          -----------------------------------
+------------------------c
gnl|hbvcds|AB194947_PreS2_P-E      -----------------------------------
+------------------------g
gnl|hbvcds|AB194948_PreS2_P-E      -----------------------------------
+------------------------g
                                                                      
+                         

gnl|hbvcds|AB014370_PreC_P-A       tagagtctcctgagcattgctcacctcaccatact
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB064314_PreC_P-A       tagagtctcctgagcattgctcacctcaccatacg
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB014384_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB014385_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB048701_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB078031_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB030513_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB064314_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194947_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194948_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
                                     *  * **  *   *       ****** **** 
+***        *    *  *    *
[download]

Regards

That's because your "actual data" from the previous reply was different to the data in the last one. To accommodate, just change the regex to match the empty lines. The exact form is left as an exercise to the reader.
لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ