calculating length of the string

GSperlbio has asked for the wisdom of the Perl Monks concerning the following question:

Im having sequence "CUGUACAGCCUCCUAGCUUUCC" in the file "rna.txt" i need to get the length of the sequence as 22 instead im getting 23. can anyone help me to correct this error?? this is my code:

#!usr/bin/perl
use warnings; 
open (RH, "<rna.txt") || die "cant open the file";
my $arr2 = <RH>;
print "rna sequence is $arr2";
$len2= length($arr2);
print $len2;
[download]

Comment on calculating length of the string Download Code

Replies are listed 'Best First'.
Re: calculating length of the string by Eily (Monsignor) on Jul 29, 2015 at 09:35 UTC
First, see Writeup Formatting Tips on how to write a nice looking post. When it's done, you can look at chomp to remove the extra character at the end of your string ("\n", marking the end of the line)	[reply]
Re: calculating length of the string by vinoth.ree (Monsignor) on Jul 29, 2015 at 09:50 UTC
++Eily, As you read the file content each line ends with newline character `'\n'`, perl has function `chomp()` it removes characters at the end of strings corresponding to the $INPUT_LINE_SEPARATOR ($/), When given no arguments, the operation is performed on $_. `use strict; use warnings; my $arr2 = <DATA>; chomp($arr2); print "rna sequence is $arr2\n"; my $len2= length($arr2); print $len2; __DATA__ CUGUACAGCCUCCUAGCUUUCC` [download] *All is well. I learn by answering your questions...*	[reply] [d/l] [select]
Re^2: calculating length of the string by locked_user sundialsvc4 (Abbot) on Jul 29, 2015 at 13:09 UTC
... and, just to be 100% clear, the bit o’ magick that you would be looking for, in the above code snippet, is the call to `chomp()`.