Re: calculating length of the string

++Eily,

As you read the file content each line ends with newline character '\n', perl has function chomp() it removes characters at the end of strings corresponding to the $INPUT_LINE_SEPARATOR ($/), When given no arguments, the operation is performed on $_.

use strict;
use warnings;

my $arr2 = <DATA>;
chomp($arr2);
print "rna sequence is $arr2\n";
my $len2= length($arr2);
print $len2;

__DATA__
CUGUACAGCCUCCUAGCUUUCC
[download]

All is well. I learn by answering your questions...

Comment on Re: calculating length of the string Select or Download Code

Replies are listed 'Best First'.
Re^2: calculating length of the string by locked_user sundialsvc4 (Abbot) on Jul 29, 2015 at 13:09 UTC
... and, just to be 100% clear, the bit o’ magick that you would be looking for, in the above code snippet, is the call to `chomp()`.