Re: Print A Sequence with Start codon and different Stop Codon

It's not clear what output you expect. To search for overlapping sequences, you can change the second group from non-grouping to a look-behind:

$sequence =~ /(ATG.*?(?<=TAA|TAG|TGA))/g
[download]

to get

ATGGTTTCTCCCATCTCTCCATCGGCATAA
ATGA
[download]

It still extracts the shortest possible sequence for each starting point (so we lost the second output).

Update: It's possible to get all the sequences without experimental regex features and depending on the return value of print like here.

my @from;
my $pos = -1;
push @from, $pos while -1 != ($pos = index $sequence, 'ATG', $pos + 1)
+;

my @to;
for my $end (qw( TAA TAG TGA )) {
    $pos = -1;
    push @to, $pos + 3 while -1 != ($pos = index $sequence, $end, $pos
+ + 1);
}

for my $f (@from) {
    for my $t (@to) {
        say substr $sequence, $f, $t - $f if $t > $f;
    }
}
__END__
Output:

ATGGTTTCTCCCATCTCTCCATCGGCATAA
ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA
ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGA
ATGATCTAA
ATGA
[download]

لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ

Comment on Re: Print A Sequence with Start codon and different Stop Codon Select or Download Code

Replies are listed 'Best First'.
Re^2: Print A Sequence with Start codon and different Stop Codon by Anonymous Monk on Oct 27, 2015 at 23:52 UTC
Yes, but it was so much fun :) #!/usr/bin/perl -l # http://perlmonks.org/?node_id=1146191 use strict; use warnings; my $sequence = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA' +; while( $sequence =~ /ATG/g ) { my $rest = $'; print 'ATG' . $` . $1 while $rest =~ /(TAG\|TAA\|TGA)/g; } [download]	[reply] [d/l]
Re^3: Print A Sequence with Start codon and different Stop Codon by PerlKc (Novice) on Oct 28, 2015 at 01:42 UTC
I tried that, but my output should be set of sequences with start codon ATG and end codon TAG,TAA,TGA. For example ATG...............TAA ATG...........TAG ATG.........................TGA ATG.................................TAA .......represents sequence in middle of start and stop codon	[reply]
Re^2: Print A Sequence with Start codon and different Stop Codon by PerlKc (Novice) on Oct 28, 2015 at 01:46 UTC
I tried that, but my output should be set of sequences with start codon ATG and end codon TAG,TAA,TGA. For example ATG...............TAA ATG...........TAG ATG.........................TGA ATG.................................TAA .......represents sequence in middle of start and stop codon I am looking for regex features to get the output. Thanks	[reply]