in reply to Using Recursion to Find DNA Sequences
Please could you confirm that these are the matches that you are hoping for.
AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA ^^^------------------------^^^ ^^^-------------------------------------^^^ ^^^------------------------------------------^^^ ^^^---^^^
Those are the ones I can spot using just my eyes but I might be misunderstanding your rules.
Cheers,
JohnGG
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re^2: Using Recursion to Find DNA Sequences
by clueless_perl (Initiate) on Oct 29, 2017 at 18:43 UTC | |
by AnomalousMonk (Archbishop) on Oct 29, 2017 at 19:10 UTC |