in reply to Re: unique sequences
in thread unique sequences

I don't understand the purpose of the  \K operator in the
    / ( .{9} [ATCG]{10} G \K G ) /gsx
regex in your code. It doesn't seem to have any effect except WRT $& and ${^MATCH}, which aren't used in the code:

c:\@Work\Perl>perl -wMstrict -MData::Dump -le "my $line = 'AAAATTTTCCCCGGGGAAAGGxAAAACCCCTTTTGGGGAAAGGxTTTTAAAACCCCGGGGAAAGG' ; my %unique_data; my $count; while ( $line =~ / ( .{9} [ATCG]{10} G \K G ) /gsxp ) { print qq{>crispr_@{[ ++$count ]} '$1' ($&) (${^MATCH})} unless $unique_data{$1}++; } ;; dd \%unique_data; " >crispr_1 'AAAATTTTCCCCGGGGAAAGG' (G) (G) >crispr_2 'AAAACCCCTTTTGGGGAAAGG' (G) (G) >crispr_3 'TTTTAAAACCCCGGGGAAAGG' (G) (G) { AAAACCCCTTTTGGGGAAAGG => 1, AAAATTTTCCCCGGGGAAAGG => 1, TTTTAAAACCCCGGGGAAAGG => 1, }
Can you please give me some insight on this? Is  \K simply a leftover from a previous version of the code?


Give a man a fish:  <%-{-{-{-<

Replies are listed 'Best First'.
Re^3: unique sequences
by jwkrahn (Abbot) on Dec 11, 2017 at 19:26 UTC

    Sorry, I didn't test the code well enough. I thought the capturing parenthesis would capture the look-behind pattern as well. This code will do what I originally intended:

    Updated (thanks Cristoforo)

    while ( $line =~ / (?<= .{9} [ATCG]{10} G ) G /gsx ) { my $match = substr $line, $+[ 0 ] - 21, 21; print $KMERS '>crispr_', ++$count, "\n$match\n" unless $unique_data{ $match }++; }
      I thought the capturing parenthesis would capture the look-behind pattern as well.

      It does — except I wouldn't think of what was captured as "the look-behind pattern", but simply as "the pattern" or maybe "the match." Look-around doesn't really enter in to it, and I don't see any need to bring in substr either; you already seem to have everything you need in $1, e.g. (with one repeated sequence):

      c:\@Work\Perl\monks>perl -wMstrict -MData::Dump -le "my $line = 'AAAATTTTCCCCGGGGAAAGGxAAAACCCCTTTTGGGGAAAGGxAAAATTTTCCCCGGGGAAAGG' ; ;; my (%unique_data, $count); while ($line =~ m{ (.{9} [ATCG]{10} GG) }xmsg) { print qq{>crispr_@{[ ++$count ]} '$1'} unless $unique_data{$1}++; } ;; dd \%unique_data; " >crispr_1 'AAAATTTTCCCCGGGGAAAGG' >crispr_2 'AAAACCCCTTTTGGGGAAAGG' { "AAAACCCCTTTTGGGGAAAGG" => 1, "AAAATTTTCCCCGGGGAAAGG" => 2 }

      However, I think the line-by-line processing of your code here is problematic. In the OPed code, the function  loadSequence() (supposedly) concatenates all lines of  ATCG bases in a file together before trying to extract sub-sequences of interest. In line-by-line processing, a sub-sequence may be interrupted by a newline and thus be missed.

      (OTOH, the whole 21-base-versus-12-base aspect of the OPed code leaves me puzzled; I can't quite figure out what the OPer was going for there.)


      Give a man a fish:  <%-{-{-{-<

      $+ should be $+[0] :-)