in reply to unique sequences

It looks like you need something like this: 

#!/usr/bin/perl
use strict;
use warnings;

my $input_file  = '/scratch/Drosophila/dmel-all-chromosome-r6.02.fasta
+';
my $output_file = 'unique12KmersEndingGG.fasta';

open my $FASTA, '<', $input_file  or die "Cannot open '$input_file' be
+cause: $!";
open my $KMERS, '>', $output_file or die "Cannot open '$output_file' b
+ecause: $!";

my ( $count, %unique_data );

while ( my $line = <$FASTA> ) {
    next if $line =~ /^>/;
    while ( $line =~ / ( .{9} [ATCG]{10} G \K G ) /gsx ) {
        print $KMERS '>crispr_', ++$count "\n$1\n" unless $unique_data
+{ $1 }++;
        }
    }

[download]

Replies are listed 'Best First'.
Re^2: unique sequences
by AnomalousMonk (Archbishop) on Dec 11, 2017 at 17:35 UTC

    I don't understand the purpose of the  \K operator in the
        / ( .{9} [ATCG]{10} G \K G ) /gsx
    regex in your code. It doesn't seem to have any effect except WRT $& and ${^MATCH}, which aren't used in the code: 

    c:\@Work\Perl>perl -wMstrict -MData::Dump -le
"my $line =
   'AAAATTTTCCCCGGGGAAAGGxAAAACCCCTTTTGGGGAAAGGxTTTTAAAACCCCGGGGAAAGG'
   ;
 my %unique_data;
 my $count;
 while ( $line =~ / ( .{9} [ATCG]{10} G \K G ) /gsxp ) {
   print qq{>crispr_@{[ ++$count ]} '$1' ($&) (${^MATCH})}
     unless $unique_data{$1}++;
   }
 ;;
 dd \%unique_data;
"
>crispr_1 'AAAATTTTCCCCGGGGAAAGG' (G) (G)
>crispr_2 'AAAACCCCTTTTGGGGAAAGG' (G) (G)
>crispr_3 'TTTTAAAACCCCGGGGAAAGG' (G) (G)
{
  AAAACCCCTTTTGGGGAAAGG => 1,
  AAAATTTTCCCCGGGGAAAGG => 1,
  TTTTAAAACCCCGGGGAAAGG => 1,
}

    [download]
    Can you please give me some insight on this? Is  \K simply a leftover from a previous version of the code?

    Give a man a fish:  <%-{-{-{-<

[reply]
[d/l]
[select]

      Sorry, I didn't test the code well enough. I thought the capturing parenthesis would capture the look-behind pattern as well. This code will do what I originally intended:

      Updated (thanks Cristoforo) 

      while ( $line =~ / (?<= .{9} [ATCG]{10} G ) G /gsx ) {
    my $match = substr $line, $+[ 0 ] - 21, 21;
    print $KMERS '>crispr_', ++$count, "\n$match\n"
        unless $unique_data{ $match }++;
    }

      [download]
[reply]
[d/l]
        I thought the capturing parenthesis would capture the look-behind pattern as well.

        It does — except I wouldn't think of what was captured as "the look-behind pattern", but simply as "the pattern" or maybe "the match." Look-around doesn't really enter in to it, and I don't see any need to bring in substr either; you already seem to have everything you need in $1, e.g. (with one repeated sequence): 

        c:\@Work\Perl\monks>perl -wMstrict -MData::Dump -le
"my $line =
   'AAAATTTTCCCCGGGGAAAGGxAAAACCCCTTTTGGGGAAAGGxAAAATTTTCCCCGGGGAAAGG'
   ;
 ;;
 my (%unique_data, $count);
 while ($line =~ m{ (.{9} [ATCG]{10} GG) }xmsg) {
   print qq{>crispr_@{[ ++$count ]} '$1'} unless $unique_data{$1}++;
   }
 ;;
 dd \%unique_data;
"
>crispr_1 'AAAATTTTCCCCGGGGAAAGG'
>crispr_2 'AAAACCCCTTTTGGGGAAAGG'
{ "AAAACCCCTTTTGGGGAAAGG" => 1, "AAAATTTTCCCCGGGGAAAGG" => 2 }

        [download]

        However, I think the line-by-line processing of your code here is problematic. In the OPed code, the function  loadSequence() (supposedly) concatenates all lines of  ATCG bases in a file together before trying to extract sub-sequences of interest. In line-by-line processing, a sub-sequence may be interrupted by a newline and thus be missed.

        (OTOH, the whole 21-base-versus-12-base aspect of the OPed code leaves me puzzled; I can't quite figure out what the OPer was going for there.)

        Give a man a fish:  <%-{-{-{-<

[reply]
[d/l]
[select]
        $+ should be $+[0] :-)
[reply]
[d/l]
[select]

In Section Seekers of Perl Wisdom