Mike98mm has asked for the wisdom of the Perl Monks concerning the following question:
I am new to perl.
I am trying to write a simple code to find an ORF (open reading frames)
I am trying to identify the ORF with start(ATG) and stop codons(TAA|TAG|TGA) and print out the ORF.
The nucleotide sequence:
TTCAGGTGTTTGCAACTGCGTTTTATTGCAAGAAAGAGTGGAGGGGTTTCCATGGGGCCCACCTCACAAC +CCACTC TTCACCCCCAAAATCACGCAGGGATCGGACTCAGGAAAGGGAAGCATCTGTGTGTTGCATACGAGCCCTT +CCTGTACTTACTTCTTTCACAGCAGGGAAGG AAGAGGGAAGAGGCAGCTGTGGAGAGGATCAGGTTGCGGGAGGTGGGTATCTCGCTGCTCTGACCTTACG +TACAGTCCTCCACAGAAGCATCAAAGTGGACT GGCACATATCGGCTCCCTTCACAGGCCACAATCATCTGTCTCTCCTTCGGGCTGGTCCGGTATCCAC
2018-05-02 Athanasius added code and paragraph tags
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re: REGEX help
by tybalt89 (Monsignor) on Apr 21, 2018 at 01:00 UTC | |
|
Re: REGEX help
by dorko (Prior) on Apr 21, 2018 at 01:31 UTC | |
by karlgoethebier (Abbot) on Apr 21, 2018 at 16:21 UTC | |
by poj (Abbot) on Apr 21, 2018 at 17:17 UTC | |
by dorko (Prior) on Apr 21, 2018 at 19:31 UTC | |
by Your Mother (Archbishop) on Apr 21, 2018 at 20:04 UTC | |
| |
by karlgoethebier (Abbot) on Apr 22, 2018 at 08:16 UTC | |
by karlgoethebier (Abbot) on Apr 21, 2018 at 19:22 UTC | |
|
Re: REGEX help
by Cristoforo (Curate) on Apr 21, 2018 at 01:06 UTC | |
|
Re: REGEX help
by LeBreton (Initiate) on Apr 21, 2018 at 15:19 UTC | |
by AnomalousMonk (Archbishop) on Apr 21, 2018 at 15:37 UTC |