Ya, here is a BioPerl solution to interleave to sequences: 
#!/usr/bin/env perl
use strict;
use warnings;
use Bio::SeqIO;

my $fasta_in_1 = $ARGV[0];
my $fasta_in_2 = $ARGV[1];
my $fasta_out  = ">interleave_1_2.fa";

my $seqio_in_1 = Bio::SeqIO->new(
    -file   => $fasta_in_1,
    -format => 'Fasta',
);

my $seqio_in_2 = Bio::SeqIO->new(
    -file   => $fasta_in_2,
    -format => 'Fasta',
);

my $seqio_out = Bio::SeqIO->new(
    -file   => $fasta_out,
    -format => 'Fasta',
);

while ( my $seq_obj_1 = $seqio_in_1->next_seq() ) {
    my $seq_obj_2 = $seqio_in_2->next_seq();
    $seqio_out->write_seq($seq_obj_1);
    $seqio_out->write_seq($seq_obj_2);
}
__END__
>qppq
ATATATTTATTATTATATATATTATATTATTA
>dfj
TATTATTATTTTATAT
>lsl
ATTATTATTATTATTAGGAGGAG
>ghg
ATATATAT

[download]

However, I'm not entirely sure of the best way to delimit the pairs with ============ using this approach.

In reply to Re^2: Text manipulation by frozenwithjoy
in thread Text manipulation by viktor

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.