Like this? 

[0] Perl> $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaatt
+ttt';;
[0] Perl> print $1 while $dna =~ m[atg(.+?)(?=taa|tag|tga)]g;;
gga
gcgccccggc

[download]

If so, the difference is the use of the non-greedy match quantifier +?

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re: Simple regex question. Grouping with a negative lookahead assertion. by BrowserUk
in thread Simple regex question. Grouping with a negative lookahead assertion. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.