The final key here was that the second argument to the post method needed to be an array ref (i.e., the hash arguments needed to be enclosed in []s). The code below works, returning the desired output page in the $mech object.

#!/usr/bin/perl
use warnings;
use strict;
use WWW::Mechanize;

my $hypermutUrl =
  "http://http://hiv-dev.lanl.gov/cgi-bin/HYPERMUT/hypermut.cgi";
my $mech = WWW::Mechanize->new( autocheck => 1 );

my $alignment_as_string = <<'END_SEQS';
>HIV1-test.CONS
ATGGGATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAGAGATTTATTGTGTTC
>HIV1-test.1
ATGGAATGTCTTGGAAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC
>HIV1-test.2
ATGGAATGTCTTGGGAATCAGCTGCTTATCGCGCTCTTGCTAGTAAGTGCTTTAAAGATTTATTGTGTTC
END_SEQS

$mech->post(
    $hypermutUrl,
    [
     'FORMAT'            => 'FASTA',
     'ALIGNMENT'         => $alignment_as_string,
     'upfile1'           => '',
     'INN'               => '',
     'OUT'               => '',
     'MUTUPSTREAM'       => '',
     'MUTFROM'           => 'G',
     'MUTTO'             => 'A',
     'MUTDOWNSTREAM'     => 'RD',
     'ENFORCE'           => 'DESCENDANT',
     'CONTROLUPSTREAM'   => '',
     'CONTROLFROM'       => 'G',
     'CONTROLTO'         => 'A',
     'CONTROLDOWNSTREAM' => 'YN|RC',
     'Analysis'          => 'All',
     'submit'            => 'Run',
    ]
);

my $page = $mech->content;
open my $FH, ">/tmp/hypermut.html";
print {$FH} $page; close $FH;
warn "saved webpage data to /tmp/hypermut.html\n";

[download]

Thanks to any and all who thought about it, and most particularly to my colleague who found my error.

In reply to Re^6: www::mechanize: second "submit" invisible to find_all_submits by wfischer
in thread www::mechanize: second "submit" invisible to find_all_submits by wfischer

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.