Are you saying that given the line
>hsa-let-7a-5pTGAGGTAGTAGGTTGTATAGTT
the Perl code you've shown splits it into two lines?
hsa-let-7a-5p
TGAGGTAGTAGGTTGTATAGTT
Well you "can't get your head around how it's actually doing it" because it doesn't. But shouldn't fasta files have headers on separate lines? That is, aren't header and body different lines to begin with?
>hsa-let-7a-5p
TGAGGTAGTAGGTTGTATAGTT
Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
Read Where should I post X? if you're not absolutely sure you're posting in the right place.
Please read these before you post! —
Posts may use any of the Perl Monks Approved HTML tags:
- a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
| |
For: |
|
Use: |
| & | | & |
| < | | < |
| > | | > |
| [ | | [ |
| ] | | ] |
Link using PerlMonks shortcuts! What shortcuts can I use for linking?
See Writeup Formatting Tips and other pages linked from there for more info.