Dear Choroba,

Thank you for your time and helping me with the code to develop matrix for the data.

However, the data file should not be having number 1 , 60 , this was provided by me for the clarification that its 60 column wide.

Actual data file is like this:

CLUSTAL O(1.2.1) multiple sequence alignment

                                                                      
+                    
gnl|hbvcds|AB014370_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB064314_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB014384_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB014385_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB048701_PreS1_P-D      atggggcagaatctttccaccagcaatcctctggg
+attctttcccgaccatcagttggat
gnl|hbvcds|AB078031_PreS1_P-D      atggggcagaatctttccaccagcaaccctctggg
+attctttcccgaccaccagttggat
gnl|hbvcds|AB030513_S_P-A          -----------------------------------
+-------------------------
gnl|hbvcds|AB064314_S_P-A          -----------------------------------
+-------------------------
gnl|hbvcds|AB194947_PreS2_P-E      -----------------------------------
+-------------------------
gnl|hbvcds|AB194948_PreS2_P-E      -----------------------------------
+-------------------------
                                                                      
+                         
                                                                      
+                      
gnl|hbvcds|AB014370_PreC_P-A       tagagtctcctgagcattgctcacctcaccatact
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB064314_PreC_P-A       tagagtctcctgagcattgctcacctcaccatacg
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB014384_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB014385_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB048701_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB078031_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB030513_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB064314_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194947_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194948_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
                                     *  * **  *   *       ****** **** 
+***        *    *  *    *

[download]

Please let me know where I can modify the code to incorporate the changes.

Regards

In reply to Re^2: Alignment and matrix generation by newtoperlprog
in thread Alignment and matrix generation by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.