Dear Choroba

Thank you for your time. I modified the code as per your suggestions but it seems that the code is skipping the first block of alignment and rest the occurrences of nucleotides as percentages are wrong.

I am attaching the code and the data file for the same

#!/usr/bin/perl
use strict;
use warnings;
use Syntax::Construct qw{ // };

my $endpos = 0;
my ($startpos, $count);
my %occurrences;

my $file = $ARGV[0];
open(DATA, $file);
while (<DATA>) {
    if (/^CLUSTAL.*/) {next;}
    if (/^ +$/) {
    $startpos = $endpos + 1;
    $count = 0;
    }
    elsif (/\s+ ([-actg]+) \s*$/x) {
        ++$count;
        my @nucleotides = split //, $1;
    $endpos = $endpos + length $1 if $startpos == $endpos + 1;
        for my $pos (0 .. $#nucleotides) {
            ++$occurrences{ $nucleotides[$pos] }[$startpos + $pos]
                unless '-' eq $nucleotides[$pos];
        }
    }
}

for my $pos (1 .. $endpos) {
    print "$pos\t";
    for my $nucleotide (sort keys %occurrences) {
        printf "%s\t%0.1f\t", uc $nucleotide, 100 * ($occurrences{$nuc
+leotide}[$pos] // 0) / $count;
    }
    print "\n";
}

[download]

Data file

CLUSTAL O(1.2.1) multiple sequence alignment


gnl|hbvcds|AB014370_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB064314_PreC_P-A       -----------------------------------
+-------------------------
gnl|hbvcds|AB014384_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB014385_C_P-C          -----------------------------------
+-------------------------
gnl|hbvcds|AB048701_PreS1_P-D      atggggcagaatctttccaccagcaatcctctggg
+attctttcccgaccatcagttggat
gnl|hbvcds|AB078031_PreS1_P-D      atggggcagaatctttccaccagcaaccctctggg
+attctttcccgaccaccagttggat
gnl|hbvcds|AB030513_S_P-A          -----------------------------------
+------------------------a
gnl|hbvcds|AB064314_S_P-A          -----------------------------------
+------------------------c
gnl|hbvcds|AB194947_PreS2_P-E      -----------------------------------
+------------------------g
gnl|hbvcds|AB194948_PreS2_P-E      -----------------------------------
+------------------------g
                                                                      
+                         

gnl|hbvcds|AB014370_PreC_P-A       tagagtctcctgagcattgctcacctcaccatact
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB064314_PreC_P-A       tagagtctcctgagcattgctcacctcaccatacg
+gcactcaggcaagccattctctgct
gnl|hbvcds|AB014384_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB014385_C_P-C          tagagtctccggaacattgttcacctcaccataca
+gcactcaggcaagctattctgtgtt
gnl|hbvcds|AB048701_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB078031_PreS1_P-D      gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB030513_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB064314_S_P-A          gggtttttcttgttgacaagaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194947_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
gnl|hbvcds|AB194948_PreS2_P-E      gggtttttcttgttgacaaaaatcctcacaatacc
+gcagagtctagactcgtggtggact
                                     *  * **  *   *       ****** **** 
+***        *    *  *    *

[download]

Regards

In reply to Re^4: Alignment and matrix generation by newtoperlprog
in thread Alignment and matrix generation by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.