I don't understand what your code is trying to do or why you talk about "replacements," but if you want to get a random substring from a longer string, why not just pick a random offset between 0 and the difference between the full string's length and the substring's length? Here's an iterator which does that: 

#!/usr/bin/env perl
use 5.010; use warnings; use strict;

my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT";

sub make_rand_getter {
    my $s = shift;
    my $sl = length $s;
    return sub {
        return substr $s, int rand($sl - $_[0]), $_[0];
    }
}

my $rstring = make_rand_getter($DNA);
say "3-letter string: " . $rstring ->(3);
say "7-letter string: " . $rstring ->(7);

[download]

Aaron B.
Available for small or large Perl jobs and *nix system administration; see my home node.

In reply to Re: Generating mulitple random strings of a set length by aaron_baugher
in thread Generating mulitple random strings of a set length by Kajed

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.