Hi all, I am new user in perl, I want to extract two values from XML file and save them in new file. The values are ssId and subSnpClass. I create the following code, but it just print ssId twice and does not print subSnpClass. Any idea about how to fix it. Thanks

my $Gene='ds_chY.xml';
my $filename = 'ID.txt';
my $ID;
my $subSnpClass;
open(my $fh, '>', $filename) or die "Could not open file '$filename' $
+!";
print $fh "RS_SNPs\tsubSnpClass";
open(GTFFILE, $Gene) or die ("Cannot open the file");
while(<GTFFILE>){
$_=~ s/^\s+//;
if ($_= ~/ssId=\s*?(\S+)/)
{
$ID=$1;
$ID =~ s/"//;
chop $ID;
print $fh "$ID\n";
}
if ($_= ~/subSnpClass=\s*?(\S+)/)
{
$subSnpClass=$1;
$subSnpClass =~ s/"//;
chop $subSnpClass;
print $fh "\t$subSnpClass\n";
}
}

[download]

Here is sample of my input file

===========================================================

<?xml version="1.0" encoding="UTF-8"?>
<ExchangeSet xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xml
+ns="http://www.ncbi.nlm.nih.gov/SNP/docsum" xsi:schemaLocation="http:
+//www.ncbi.nlm.nih.gov/SNP/docsum ftp://ftp.ncbi.nlm.nih.go
v/snp/specs/docsum_3.4.xsd" specVersion="3.4" dbSnpBuild="144" generat
+ed="2015-05-26 09:54">
    <SourceDatabase taxId="9606" organism="human" gpipeOrgAbbr="hs"/>
    <Rs rsId="3894" snpClass="snp" snpType="notwithdrawn" molType="gen
+omic" genotype="true" bitField="050028000005130500030100" taxId="9606
+">
        <Het type="est" value="0.05" stdError="0.1547"/>
        <Validation byCluster="true" byOtherPop="true" byHapMap="true"
+ by1000G="true">
            <otherPopBatchId>7179</otherPopBatchId>
        </Validation>
        <Create build="36" date="2000-09-19 17:02"/>
        <Update build="144" date="2015-05-07 10:52"/>
        <Sequence exemplarSs="491581208" ancestralAllele="C,C">
            <Seq5>ATAAGCAAATAACTGAAGTTTAATCAGTCTCCTCCCAGCAAGTGATATGCAA
+CTGAGATTCCTTATGACACATCTGAACACTAGTGGATTTGCTTTGTAGTAGGAACAAGGTACATTCGCG
+GGATAAATGTGGCCAAGTTTTATCTGCTGCCAGGGCTTTCAAATAGGTTGACCTGACAA
TGGGTCACCTCTGGGACTGA</Seq5>
            <Observed>C/T</Observed>
            <Seq3>AATTAGGAAGAGCTGGTACCTAAAATGAAAGATGCCCTTAAATTTCAGATTC
+ACAATTTTTTTTTCTTAGTATAAGCATGTCCCATGTAATATCTGGGATATACTCATACCTTTAAAAATG
+TGCTCATTGTTTATCTGAAATTCACATTTTAACAGGGAACCATTGTTTTGTTATTGTTT
ATTGTTTTGTTTCTAAATAA</Seq3>
        </Sequence>
        <Ss ssId="3931" handle="OEFNER" batchId="489" locSnpId="M3" su
+bSnpClass="snp" orient="forward" strand="bottom" molType="genomic" bu
+ildId="36" methodClass="DHPLC" validated="by-cluster">
            <Sequence>
                <Seq5>TAATCAGTCTCCTCCCAGCAAGTGATATGCAACTGAGATTCCTTATGA
+CACATCTGAACACTAGTGGATTTGCTTTGTAGTAGGAACAAGGTACATTCGCGGGATAAATGTGGCCAA
+GTTTTATCTGCTGCCAGGGCTTTCAAATAGGTTGACCTGACAATGGGTCACCTCTGGGA
CTGA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>AATTAGGAAGAGCTGGTACCTAAAATGAAAGATGCCCTTAAATTTCAG
+ATTCACAATTTT</Seq3>
            </Sequence>
        </Ss>
        <Ss ssId="76536062" handle="AFFY" batchId="52074" locSnpId="AF
+FY_6_1M_SNP_A-8397107" subSnpClass="snp" orient="forward" strand="bot
+tom" molType="genomic" buildId="130" methodClass="hybridize
" validated="by-submitter">
            <Sequence>
                <Seq5>TCACCTCTGGGACTGA</Seq5>
                <Observed>C/T</Observed>
                <Seq3>AATTAGGAAGAGCTGG</Seq3>
            </Sequence>
        </Ss>

[download]

In reply to Print multiple value from file by Helan_Ahmed

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.