Also, I note a reference to codons, which implies that your tests should be considering a stride of 3 rather than an arbitrary position.

This is an excellent point. For the benefit of the OP, here is one way to ensure that only codon-sequences are captured:

#! perl
use strict;
use warnings;

my $seq = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA';

# Adapted from the regex by stevieb
my $re =
qr{
    (                           # capture each sequence:
        ATG                     # - which begins with the codon ATG
        (?: [ACGT]{3} )*?       # - followed by the smallest number of
+ codons
        (?: TAG | TAA | TGA )   # - and ending with the codon TAG, TAA
+, or TGA
    )
}x;

print "$1\n" while $seq =~ /$re/g;

[download]

(This assumes that only minimal sequences are wanted — an assumption which should be clarified, as Laurent_R has pointed out, above.)

Hope that helps,

Athanasius <°(((>< contra mundum Iustus alius egestas vitae, eros Piratica,

In reply to Re^2: Regular expressions by Athanasius
in thread Regular expressions by lairel

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.