I think the documentation is a little misleading here. At least, it gives me the impression that the first match (if any) is somehow guaranteed to be valid (because codon-aligned). But that’s true only if, as in the example given, the $dna string happens to contain a valid match somewhere — in which case, it will be found first. But if it doesn’t, the first match is an invalid one:

#! perl
use strict;
use warnings;

while (my $dna = <DATA>)
{
    chomp $dna;
    print "\n\$dna = '$dna'\n";

    while ($dna =~ /(\w\w\w)*?TGA/g)
    {
        print 'Got a TGA stop codon at position ', pos $dna, 
              ', immediately following [', $1, "]\n";
    }
}

__DATA__
ATCGTTGAA
ATCGTTGAATGCAAATGACATGAC
[download]

Output:

 0:10 >perl 1476_SoPW.pl

$dna = 'ATCGTTGAA'
Got a TGA stop codon at position 8, immediately following [CGT]

$dna = 'ATCGTTGAATGCAAATGACATGAC'
Got a TGA stop codon at position 18, immediately following [AAA]
Use of uninitialized value $1 in print at 1476_SoPW.pl line 43, <DATA>
+ line 2.
Got a TGA stop codon at position 23, immediately following []

 0:10 >
[download]

Adding a \G anchor to the regex:

while ($dna =~ /\G(\w\w\w)*?TGA/g)
[download]

fixes the results for both dna strings, because \G means Match only at pos() (e.g. at the end-of-match position of prior m//g) (see “Assertions” in perlre), and initially pos() is set at zero.

<Begin update> choroba is of course correct, anchoring to the start of the string finds only the first match.

while ($dna =~ /^(\w\w\w)*?TGA/g)
[download]

<End update>

Perhaps not Perl documentation’s finest hour. :-)

Hope that helps,