The following is a parallel demonstration for the fasta benchmark on the web. It runs nearly 3x faster versus the original code.

Although nothing is relayed between workers, the relay capabilities in MCE is helpful for running a section of code orderly. A shared-scalar variable is used for retaining the $LAST value between chunks and subsequent runs.

# perl fasta.pl 25000000

# The Computer Language Benchmarks game
# http://benchmarksgame.alioth.debian.org/
#
# contributed by Barry Walsh
# port of fasta.rb #6
#
# MCE version by Mario Roy

use strict;
use warnings;
use feature 'say';

use MCE;
use MCE::Candy;
use MCE::Shared;

use constant IM => 139968;
use constant IA => 3877;
use constant IC => 29573;

my $LAST = MCE::Shared->scalar(42);

my $alu =
    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';

my $iub = [
    [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
    [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
    [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
    [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
    [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
];

my $homosapiens = [
    [ 'a', 0.3029549426680 ],
    [ 'c', 0.1979883004921 ],
    [ 'g', 0.1975473066391 ],
    [ 't', 0.3015094502008 ]
];

sub make_repeat_fasta {
    my ($src, $n) = @_;
    my $width = qr/(.{1,60})/;
    my $l     = length $src;
    my $s     = $src x (($n / $l) + 1);
    substr($s, $n, $l) = '';

    while ($s =~ m/$width/g) { say $1 }
}

sub make_random_fasta {
    my ($table, $n) = @_;
    my $rand   = undef;
    my $width  = 60;
    my $prob   = 0.0;
    my $output = '';
    my ($c1, $c2, $last);

    $_->[1] = ($prob += $_->[1]) for @$table;

    $c1  = '$rand = ($last = ($last * IA + IC) % IM) / IM;';
    $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$
+table;

    my $code1 = q{
        my ($mce, $seq, $chunk_id) = @_;

        # process code-snippet orderly between workers
        MCE->relay_recv;

        my $last = $LAST->get;
        my $temp = $last;

        # pre-compute $LAST for the next worker
        for (1 .. ($seq->[1] - $seq->[0] + 1) * $width) {
            $temp = ($temp * IA + IC) % IM;
        }

        $LAST->set($temp);
        MCE->relay;

        # process code-snippet in parallel
        for ($seq->[0] .. $seq->[1]) {
            for (1..$width) { !C! }
            $output .= "\n";
        }

        # gather output orderly
        MCE->gather($chunk_id, $output);

        $output = '';
    };

    $code1 =~ s/!C!/$c1/g;

    MCE->new(
        bounds_only => 1,
        chunk_size  => 2000,
        init_relay  => 0,
        max_workers => 4, ## MCE::Util->get_ncpu || 4,
        sequence    => [ 1, ($n / $width) ],
        gather      => MCE::Candy::out_iter_fh(\*STDOUT),
        user_func   => sub { eval $code1; },
        use_threads => 0,
    )->run;

    $last = $LAST->get;

    $c2  = '$rand = ($last = ($last * IA + IC) % IM) / IM;';
    $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table
+;

    my $code2 = q{
        if ($n % $width != 0) {
            for (1 .. $n % $width) { !C! }
            print "\n";
        }
    };

    $code2 =~ s/!C!/$c2/g;
    eval $code2;

    $LAST->set($last);
}

my $n = $ARGV[0] || 27;

say ">ONE Homo sapiens alu";
make_repeat_fasta($alu, $n*2);

say ">TWO IUB ambiguity codes";
make_random_fasta($iub, $n*3);

say ">THREE Homo sapiens frequency";
make_random_fasta($homosapiens, $n*5);

[download]

Regards, Mario.

In reply to Fasta benchmark with multi-core processing via MCE by marioroy

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.