Hi everybody, I need help with a Perl/CGI task.

I reported my code below; I simplified it without using real data so to make it shorter

Essentially I have an hash of many sequences (only reported 2 in the example below)

In my hash the keys are the names of the sequences, while the values are the nucleotide sequences (DNA)

I want to iterate through the hash and filter it to make another hash only with those sequences which have

at least one of the patterns AGGAG or TTTTT; also if one, or both this patterns are present, I want to highlight them

in the sequences with 2 different colours. Until here, everything is fine. However some of my real sequences are very long (1000 nucleotides)

so I would like to print each sequence with 50 or 60 characters per line in my cgi page, to look more tidy.

In the code below I filtered the first hash with a regex and I added coloured tags to those 2 patterns I am looking for

The problem is that the unpack function messes up with the presence of the tags, which are included in the

characters count when unpacking and printing; therefore each line end up being of different length, or, even worse, some tag break because

they span 2 lines if they are in the location at which the unpacking is going to the next line

I have been trying to sort this out but I can not find a solution

I am a beginner, and I would like to find a simple solution, if there is one; without using extra modules, if possible

also because I do not have admin privileges in the Unix machine I am using

Many thanks 

 
#!/usr/bin/perl
use strict;
use warnings;
use Bio::SeqIO;
use CGI;

my $cgi = new CGI;
print $cgi->header();

print <<__EOF;
<html>
<head>
<style type='text/css'>
<!--
body {  background: lightgrey;
        color: black; 
    font-family: Courier;
        margin:20px; }


h1   {  color: black;
    font-family: Verdana;
        font-size: 150%; }

h2   {  color:red; 
    font-family: Courier; }

.sd {
          color:red;
        }
.terminator {
             color: royalblue;
}



-->
</head>    
</style>

<h1>
Sequences with <span class="sd"> SD sequence</span>  or <span class="t
+erminator">terminator structure</span>:
</h1>

<body>


__EOF

my %hash;
my $name1= "name1";
my $name2= "name2";

$hash{$name1} = "ATATTATCCCCCTATATATGGAGGGAGAGGGGGGGGGGGGGGGGGGGGGGGGG
+GGAGAGAGGAGATTTTTTTTTTTTTTTT"
$hash{$name2} = "ATATATTATATATATTATATTCGCGCGCGCGGCGCGCGCGGCGCGCGCGTTTT
+TTTTTTTTTTAGGAGAGAGAGGGAGGAGGAGAGGGGAGT"

foreach my $key (keys %hash)  {
       if ($hash{$key} =~ s!(aggag)!<span class="sd">$1</span>!gi)  { 
+ 
           $hash2{$key} = $hash{$key};
   }
  if ($hash{$key} =~ s!(ttttt)!<span class="terminator">$1</span>!ig) 
+ {  
           $hash2{$key} = $hash{$key};
   }


my %hash2;

foreach my $key (keys %hash2)  {


print "<p> <b>$key</b><input type='radio' name='selected_intergenic' v
+alue='$hash2{$key}'/> </p>";


print "<p>$_</p>\n" for unpack '(A50)*', $hash2{$key};


}

print <<__EOF;

<br />


</body>
</html>
__EOF

[download]

In reply to Print N characters per line in Cgi Script with Html Tags by Diesel

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.