This counts along the string and inserts line breaks at regular intervals

#!/usr/bin/perl
use strict;
use warnings;
use CGI;

my $WIDTH = 40;

my %hash = (
 'name1' => "ATATTATCCCCCTATATATGGAGGGAGAGGGGGGGGGGGGGGGGGGGGGGGGGGGAG
+AGAGGAGATTTTTTTTTTTTTTTT",
 'name2' => "ATATATTATATATATTATATTCGCGCGCGCGGCGCGCGCGGCGCGCGCGTTTTTTTT
+TTTTTTAGGAGAGAGAGGGAGGAGGAGAGGGGAGT",
);

my @select=();
my %pattern = (
  'AGGAG' => 'sd',
  'TTTTTTT' => 'terminator'
);
my $re = join '|',keys %pattern;

# add markup
foreach my $key (sort keys %hash)  {
  if ($hash{$key} =~ s!($re)!<span class="$pattern{$1}">$1</span>!g){
    push @select,$key;
  }
}

# create table
my $table = q!<table width="100" cellpadding="5" cellspacing="5">
<tr style="font-style:italic">
  <td width="20%">Key</td>
  <td width="5%">&nbsp;</td>
  <td width="75%">Sequence</td>
</tr>!;

# selected keys
foreach my $key (@select)  {
  my $seq = $hash{$key};
  
  # count ACTG character to determine 
  # position to insert line breaks
  my $count = 0; my @br;
  for my $p (0..length($seq)-1){
    ++$count if substr($seq,$p,1) =~ /[ACTG]/;
    if ($count > $WIDTH){
      push @br,$p;
      $count = 1;
    };
  }
  
  # insert line breaks working backwards
  for my $p (reverse @br){
    substr($seq,$p,0,'<br/>');
  }
  
  # create row
  my $radio = qq!<input type="radio" name="selected_intergenic" value=
+"$key"/>!;
  $table .= qq!<tr valign="top">
  <td>$key</td>
  <td>$radio</td>
  <td>$seq</td></tr>!;
}
$table .= q!</table>!;

# html page 
my $q = CGI->new;

my $style = <<EOF;
body {  
  background: lightgrey; color: black; 
  font-family: Courier; margin:20px; }
h1 { color: black; font-family: Verdana; font-size: 150%; }
h2 { color:red; font-family: Courier; }
.sd { color:red; }
.terminator { color: royalblue; }
EOF

my $note = qq!Sequences with <span class="sd"> SD sequence</span>  
or <span class="terminator">terminator structure</span>!;

print $q->header,
$q->start_html(-style=>{'code'=>$style}),
$q->h1( $note ),
$table,
$q->end_html;

[download]
poj

In reply to Re: Print N characters per line in Cgi Script with Html Tags by poj
in thread Print N characters per line in Cgi Script with Html Tags by Diesel

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.