Hello. Welcome.

I think you want to look at BioPerl.

This code is completely untested. I didn't want to install BioPerl on my system. But it might work if you can get BioPerl installed. (I know you're new to Perl, so installing BioPerl might be a stretch, but this might help: http://bioperl.org/INSTALL.html.) 

#!/bin/perl
use strict;
use warnings;
use Bio::Seq;
use Data::Dumper::Simple;
use feature "say";

# Convert the sequence to lower case.  Upper Case might be ok,
# but the docs for Bio::Seq used lower case, so let's go with that.
my $letters = lc("TTCAGGTGTTTGCAACTGCGTTTTATTGCAAGAAAGAGTGGAGGGGTTTCCA
+TGGGGCCCACCTCACAACCCACTC TTCACCCCCAAAATCACGCAGGGATCGGACTCAGGAAAGGGAAG
+CATCTGTGTGTTGCATACGAGCCCTTCCTGTACTTACTTCTTTCACAGCAGGGAAGG AAGAGGGAAGA
+GGCAGCTGTGGAGAGGATCAGGTTGCGGGAGGTGGGTATCTCGCTGCTCTGACCTTACGTACAGTCCTC
+CACAGAAGCATCAAAGTGGACT GGCACATATCGGCTCCCTTCACAGGCCACAATCATCTGTCTCTCCT
+TCGGGCTGGTCCGGTATCCAC");

#Create a sequence object.
my $seq_object = Bio::Seq->new(-seq => $letters,
                         -alphabet => 'dna' );

#Look for the ORF.  I specified the start, but I didn't see how to 
#specify the stop.  Are the stop codons universal?  I'm way out of
#my league here.
$prot_object = $seq_object->translate( -orf => 1, -start => "atg" );

say Dumper $prot_object;

[download]

Cheers,

Brent

-- Yeah, I'm a Delt.

In reply to Re: REGEX help by dorko
in thread REGEX help by Mike98mm

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.