In general, it seems like you want to take the sequence of charaters in $A, make sure $B contains those characters, in that sequence, but with other stuff inbetween them. Then you want a list of the other stuff.

This should do it: 

#!/usr/bin/perl
use warnings;
use strict;

my $A = 'ATGGAGTCGACGAATTTGAAGAAT';
my $B = 'xxxxxxATGGAGyxxxTCGAzxxxxCGAATTTGAAxxwGAAT';

my @A = split //, $A;
my $Are = '^(.*)' . join('(.*)', @A) . '(.*)$';
my @introns = ($B =~ m/$Are/);
if (!@introns) {
 die "There was no possible way to match the input.";
}
foreach (0..$#introns) {
 print "$_: $introns[$_] $A[$_]\n";
}

[download]
That should give you @introns as a list of everything that /didn't/ match. There will be zero-length strings for each position in which there was no junk, and otherwise the junk. Look at the output, and you'll see what I mean. Also, if there is more then one way of matching $B against $A, this will take each section of @introns to be as long as possible. If you'd prefer it as short as possible, that's easily possible. In either case, it will try it's hardest to get them to match. It will allow both leading and trailing junk, though your example only has trailing junk. These are left as exercises for the reader.

Update: Major revisions to code, changed caveats, tested.

Warning: Unless otherwise stated, code is untested. Do not use without understanding. Code is posted in the hopes it is useful, but without warranty. All copyrights are relinquished into the public domain unless otherwise stated. I am not an angel. I am capable of error, and err on a fairly regular basis. If I made a mistake, please let me know (such as by replying to this node).

In reply to Re: Complicated pattern match by theorbtwo
in thread Complicated pattern match by dr_jgbn

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.