my $dna = 'accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca'; my $increment = 3; my @windows; for ( my $loc=0; $loc <= (length($dna)-10); $loc+=$increment ){ push @windows, substr($dna, $loc, 10); } print "$_\n" for @windows;

If you have multiple $dna sequences you'll probably want an outer loop to iterate over an array holding them. Otherwise, this code ought to do what you're looking for.

It's one of the few instances where I would actually use a C-style 'for' loop.

You could also do it with a regexp.

Update: Replaced (length($dna)-$increment) with (length($dna)-10) per duff's comment. Good catch!


Dave


In reply to Re: substr help by davido
in thread substr help by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.