#!/your/perl/here
use strict;
use warnings;
my $sequence;

while (my $line = <>)
{
# Sequence keyword
if ($line =~ /^Sequence:\s+(contig\d+)/)
{
$sequence = $1; # save the sequence
next;
}

# Parameter keyword
#next if ($line =~ /^Parameters:\s+(.*)$/)

# print any other non-blank lines
if ($line != /^\s*$/)
{
print "$sequence $line";
next;
}
}

QM..

I have tried your script, before i mark the parameter keyword out, the script have compilation error at line 24. After i mark that line, i manage to run the script with error, the compiler stated : isn't numeric in numeric ne (!=) at trf.pl line 19. But I still manage to get the output, after edited in excel. But funny thing is that, for those result starting from 1 (eg: 1 45 7 6.4 7 97 0 72 35 44 4 15 1.67 CCTAAAC CCTAAACCCTAAACCCTAAACCCTAAACCCTAAGCCCTAAGCCCT, it won't show in the parsed result... i wonder what's with this.. but anyway thank u so much!

In reply to Re^2: Perl Parser, need help by joomanji
in thread Perl Parser, need help by joomanji

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.