I have just started using WWW::Mechanize, so this is a very basic problem, undoubtedly. I have the following code that queries a web service. It is a pretty straightforward query of this page, primer3. 
# URL for primer3
my $url = 'http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi';

use WWW::Mechanize;

my $mech = WWW::Mechanize->new();

$mech->get($url);

# set up input to form
$mech->field('SEQUENCE','ACAGCNTCTGTTGACTCCCCTGCCAGCAAGCCCACTGGCCTGAGC
+ACATGAAGTCCTGCACCCAGTCAGGAGAAGGAGCGCTCCTGGCACCAGCAGGAGCTGGCAAAGGCTCTG
+GAGAGCTTAGAAAGGGAAAAAATGGAGCTGGAAATGAGGCTAAAGGAGCAGCAGACAGAAATGGAGGCC
+ATCCAGGCCCAGAGGGAAGAAGAACGGACCCAGGCAGAGAGTGCCCTATGCCAGATGCAGCTGGAAACA
+GAGAAGGAGAGAGTATCCCTCCTGGAGACACTGCTGCAGACGCAGAAGGAGCTAGCAGATGCCAGCCAA
+CAACTGGACGGAACTGAGGCAA');
$mech->field('PRIMER_NUM_RETURN',1);

# just for debugging purposes
print $mech->content();

# Get response by clicking submit button
my $resp = $mech->click('Pick Primers');

print "\n\n******* AND Response *********\n\n";
print $resp->content();

[download]
No problems except that the "click" method produces the result from the results page:
Did not see the 'Pick Primers' query parameter at /usr/local/apache2/c
+gi-bin/primer3/primer3_www_results.cgi line 117
        main::main() called at /usr/local/apache2/cgi-bin/primer3/prim
+er3_www_results.cgi line 105

[download]
I can't figure out why this is the case. The web page works fine interactively and the CGI script that handles the response does a simple check like 
  if ($query->param('Pick Primers')) {
      process_input($query);
  } else {
      confess "Did not see the 'Pick Primers' query parameter"
  }

[download]
Any help would be much appreciated.

Sean

Update: Does this have anything to do with having a space in the parameter name/value? I have tried this code with a couple of other websites without problems--the only difference seems to be the presence of the space in the parameter name 'Pick Primers'.

In reply to WWW::Mechanize and submit button question by srdst13

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.