srdst13 has asked for the wisdom of the Perl Monks concerning the following question:

I have just started using WWW::Mechanize, so this is a very basic problem, undoubtedly. I have the following code that queries a web service. It is a pretty straightforward query of this page, primer3. 
# URL for primer3
my $url = 'http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi';

use WWW::Mechanize;

my $mech = WWW::Mechanize->new();

$mech->get($url);

# set up input to form
$mech->field('SEQUENCE','ACAGCNTCTGTTGACTCCCCTGCCAGCAAGCCCACTGGCCTGAGC
+ACATGAAGTCCTGCACCCAGTCAGGAGAAGGAGCGCTCCTGGCACCAGCAGGAGCTGGCAAAGGCTCTG
+GAGAGCTTAGAAAGGGAAAAAATGGAGCTGGAAATGAGGCTAAAGGAGCAGCAGACAGAAATGGAGGCC
+ATCCAGGCCCAGAGGGAAGAAGAACGGACCCAGGCAGAGAGTGCCCTATGCCAGATGCAGCTGGAAACA
+GAGAAGGAGAGAGTATCCCTCCTGGAGACACTGCTGCAGACGCAGAAGGAGCTAGCAGATGCCAGCCAA
+CAACTGGACGGAACTGAGGCAA');
$mech->field('PRIMER_NUM_RETURN',1);

# just for debugging purposes
print $mech->content();

# Get response by clicking submit button
my $resp = $mech->click('Pick Primers');

print "\n\n******* AND Response *********\n\n";
print $resp->content();

[download]
No problems except that the "click" method produces the result from the results page:
Did not see the 'Pick Primers' query parameter at /usr/local/apache2/c
+gi-bin/primer3/primer3_www_results.cgi line 117
        main::main() called at /usr/local/apache2/cgi-bin/primer3/prim
+er3_www_results.cgi line 105

[download]
I can't figure out why this is the case. The web page works fine interactively and the CGI script that handles the response does a simple check like 
  if ($query->param('Pick Primers')) {
      process_input($query);
  } else {
      confess "Did not see the 'Pick Primers' query parameter"
  }

[download]
Any help would be much appreciated.

Sean

Update: Does this have anything to do with having a space in the parameter name/value? I have tried this code with a couple of other websites without problems--the only difference seems to be the presence of the space in the parameter name 'Pick Primers'.

Replies are listed 'Best First'.
Re: WWW::Mechanize and submit button question
by marto (Cardinal) on Aug 08, 2005 at 13:08 UTC
    Hi,

    try something like this: 
    #!/usr/bin/perl
use WWW::Mechanize;
# URL for primer3
my $url = 'http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi';
my $mech = WWW::Mechanize->new();

$mech->get($url);
$sequence='ACAGCNTCTGTTGACTCCCCTGCCAGCAAGCCCACTGGCCTGAGCACATGAAGTCCTGC
+ACCCAGTCAGGAGAAGGAGCGCTCCTGGCACCAGCAGGAGCTGGCAAAGGCTCTGGAGAGCTTAGAAAG
+GGAAAAAATGGAGCTGGAAATGAGGCTAAAGGAGCAGCAGACAGAAATGGAGGCCATCCAGGCCCAGAG
+GGAAGAAGAACGGACCCAGGCAGAGAGTGCCCTATGCCAGATGCAGCTGGAAACAGAGAAGGAGAGAGT
+ATCCCTCCTGGAGACACTGCTGCAGACGCAGAAGGAGCTAGCAGATGCCAGCCAACAACTGGACGGAAC
+TGAGGCAA';
$primernum='1';
$mech->submit_form(
        form_number => 1,
        fields      => {
            SEQUENCE    => $sequence,
            PRIMER_NUM_RETURN   => $primernum,
                       }
    );
# and so fourth...

    [download]
    This code is untested as I dont have internet access from a machine running perl at the moment.
    The documentation for WWW::Mechanize .
    Let me how that turns out.

    Martin
[reply]
[d/l]
      Martin,

      Thanks for the reply. However, I get the same response using both sets of code. I think the code you posted and mine are functionally the same, if my reading of the docs is correct, except that submit_form does not click a button for the form submission. Since the CGI is looking for the submit button parameter to be present and true, I think I need the "click" method there.

      Sean
[reply]
        Hi Sean,

        Sorry that didnt work.
        Try using the following to submit the form rather than the method I suggested: 
        $mech->submit();

        [download]
        From the docs: "Submits the page, without specifying a button to click. Actually, no button is clicked at all."
        I think that using your code you posted and the $mech->submit(); rather than the $mech->click(); method may help.

        Thanks.

        Martin
[reply]
[d/l]
Re: WWW::Mechanize and submit button question
by saberworks (Curate) on Aug 08, 2005 at 16:02 UTC
    Since button text gets sent as a normal paremeter anyway, why not set it as a field and them submit it, rather than trying to click the button?
[reply]
      Thanks for the reply, but no go here, either. Just for my edification, why should the two methods be different?

      Sean

[reply]
        Well, they shouldn't. I figured maybe they were doing something weird with buttons & clicks, but apparently not :( I spent some time on this problem, and I have experienced the same thing you have. It doesn't matter how I use Mech to submit the "Pick Primers" - it always spits out that error. I managed to find an older version of thier code (I can't find the currently running CGI, they have only released old ones). Here is the line: 
          if ($query->param('Pick Primers')) {
      process_input($query);
  } else {
      confess "Did not see the 'Pick Primers' query parameter"
  }

        [download]
        So it's nothing fishy, I think the encoding is wrong or something. Their form encoding says:

        enctype="x-www-form-urlencoded"

        I wonder if that has anything to do with it? I passed that as an HTTP header and it made no difference. I think the only solution here is to use a proxy to sniff what your browser is sending and then use the same proxy to sniff what Mech is sending and try to reconcile the two.

        Sorry I couldn't have been of more help.
[reply]
[d/l]

Back to Seekers of Perl Wisdom