Re: WWW::Mechanize and submit button question

Hi,

try something like this:

#!/usr/bin/perl
use WWW::Mechanize;
# URL for primer3
my $url = 'http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi';
my $mech = WWW::Mechanize->new();

$mech->get($url);
$sequence='ACAGCNTCTGTTGACTCCCCTGCCAGCAAGCCCACTGGCCTGAGCACATGAAGTCCTGC
+ACCCAGTCAGGAGAAGGAGCGCTCCTGGCACCAGCAGGAGCTGGCAAAGGCTCTGGAGAGCTTAGAAAG
+GGAAAAAATGGAGCTGGAAATGAGGCTAAAGGAGCAGCAGACAGAAATGGAGGCCATCCAGGCCCAGAG
+GGAAGAAGAACGGACCCAGGCAGAGAGTGCCCTATGCCAGATGCAGCTGGAAACAGAGAAGGAGAGAGT
+ATCCCTCCTGGAGACACTGCTGCAGACGCAGAAGGAGCTAGCAGATGCCAGCCAACAACTGGACGGAAC
+TGAGGCAA';
$primernum='1';
$mech->submit_form(
        form_number => 1,
        fields      => {
            SEQUENCE    => $sequence,
            PRIMER_NUM_RETURN   => $primernum,
                       }
    );
# and so fourth...
[download]

This code is untested as I dont have internet access from a machine running perl at the moment.
The documentation for WWW::Mechanize .
Let me how that turns out.

Martin

Comment on Re: WWW::Mechanize and submit button question Download Code

Replies are listed 'Best First'.
Re^2: WWW::Mechanize and submit button question by srdst13 (Pilgrim) on Aug 08, 2005 at 13:22 UTC
Martin, Thanks for the reply. However, I get the same response using both sets of code. I think the code you posted and mine are functionally the same, if my reading of the docs is correct, except that submit_form does not click a button for the form submission. Since the CGI is looking for the submit button parameter to be present and true, I think I need the "click" method there. Sean	[reply]
Re^3: WWW::Mechanize and submit button question by marto (Cardinal) on Aug 08, 2005 at 13:32 UTC
Hi Sean, Sorry that didnt work. Try using the following to submit the form rather than the method I suggested: `$mech->submit();` [download] From the docs: "Submits the page, without specifying a button to click. Actually, no button is clicked at all." I think that using your code you posted and the $mech->submit(); rather than the $mech->click(); method may help. Thanks. Martin	[reply] [d/l]