Some experimentation with HTTP::Recorder suggests that what you want in place of $mech->click_button(value => "Fold it"); is instead: $mech->click('Action'); :

$agent->get('http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi');
$agent->form_number(1);
$agent->tick('toggles', '-noLP');
$agent->field('name', 'fakename');
$agent->tick('SVG', 'on');
$agent->field('email', name@domain.com');
$agent->field('Temp', '37');
$agent->tick('plot', 'on');
$agent->field('Params', 'RNA');
$agent->field('Sequence', 'GATTACAGATTACAGATTACA');
$agent->field('pffold', 'pf');
$agent->click('Action');

[download]

(HTTP::Recorder records scripts using "$agent" instead of "$mech".)

Viewing the HTML source of the page in question would have revealed your error:

<input type="hidden" name="rec-form1-submit-Action" value=1>
<input type="submit" name="Action" value="Fold it">
                           ^^^^^^

[download]

HTH,

planetscape

In reply to Re^3: Mechanize Problems by planetscape
in thread Mechanize Problems by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.