I commented out this line: 
#$mech->submit();

[download]
and got: 
---------- Capture Output ----------
> "c:\perl\bin\perl.exe" _new.pl
<html><title>ARG1</title>
<body bgcolor=white>
<h2 align=center>ARG1</h2><hr>
<form method="post" action="/cgi-bin/SCPD/getgene2?ARG1" enctype="appl
+ication/x-www-form-urlencoded">
<input type="submit" name="action" value="Get mapped sites" /><input t
+ype="submit" name="action" value="Get putative sites" /><input type="
+submit" name="action" value="Get intergenic region" /><br /><input ty
+pe="submit" name="action" value="Retrieve sequence" />Start<-ATG <inp
+ut type="text" name="start" value="-450" size="5" maxlength="5" />ATG
+->End <input type="text" name="end" value="50" size="5" maxlength="5"
+ /><div></div></form><hr>
<pre>
>YOL058W  ARG1  218759  219259
CGAGCTTTTTCACTGCAGTAATTCTCCACATGGGCCCAGCCACTGAGATA
AGAGCGCTATGTTAGTCACTACTGACGGCTCTCCAGTCATTTATGTGATT
TTTTAGTGACTCATGTCGCATTTGGCCCGTTTTTTTCCGCTGTCGCAACC
TATTTCCATTAACGGTGCCGTATGGAAGAGTCATTTAAAGGCAGGAGAGA
GAGATTACTCATCTTCATTGGATCAGATTGATGACTGCGTACGGCAGATA
GTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGTCTCAATAGTAT
ATTAATGGGCATACATTCGTACTCCCTTGTTCTTGCCCACAGTTCTCTCT
CTCTTTACTTCTTGTATCTTGTCTCCCCATTGTGCAGCGATAAGGAACAT
TGTTCTAATATACACGGATACAAAAGAAATACACATAATTGCATAAAATA
ATGTCTAAGGGAAAAGTTTGTTTGGCTTATTCTGGTGGTTTAGATACCTC

> Terminated with exit code 0.

[download]
From the docs:
$mech->submit()
Submits the page, without specifying a button to click. Actually, no button is clicked at all.

In reply to Re: Click button not working in WWW::Mechanize by wfsp
in thread Click button not working in WWW::Mechanize by monkfan

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.