Tested (albeit, non-rigorously) BrowserUK's with a data file (very modestly varied from OP) eq:

>DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGGA
+GGGAGG*
">DL;H2_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGG
+AGGGAGG*" line 2
>DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCDLTCGCTGCCCAGC--CCCGGG
+GAGGGAGG* line3
>DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGGA
+GGGAGG line 4
>DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGG*GG
+AGGGAGG line 5

[download]

and output is:

>H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG
">H2_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG"
+ line 2
>H1_ENSP00000194530_chr2_202024 CCCCGCCTTCDLTCGCTGCCCAGCCCCGGGGAGGGAGG
+ line3
>H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG l
+ine 4
>H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG l
+ine 5

[download]

Nice, BrowserUK; ++

Update: Fixed the mis-attribution. Give BrowserUK another ++ and I'll do penance in the dungeon; the more so, since it was he who answered a brain_dead question about his code.

In reply to Re^2: Substitution on a sequence by ww
in thread Substitution on a sequence by uvnew

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.