uvnew has asked for the wisdom of the Perl Monks concerning the following question:
Then I would like it to become:>DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGGAGGGAGG*
Each sequence is actually a few hundred letters, I assume it doesn't matter.>H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG
Thanks a lot for any idea!
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re: Substitution on a sequence
by ww (Archbishop) on Jan 29, 2007 at 15:51 UTC | |
|
Re: Substitution on a sequence
by BrowserUk (Patriarch) on Jan 29, 2007 at 16:30 UTC | |
by ww (Archbishop) on Jan 29, 2007 at 16:55 UTC | |
|
Re: Substitution on a sequence
by davorg (Chancellor) on Jan 29, 2007 at 15:40 UTC | |
|
Re: Substitution on a sequence
by glasswalk3r (Friar) on Jan 29, 2007 at 17:39 UTC |