in reply to Substitution on a sequence

I believe you want that:

DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGGAGGGAGG*

To became:

H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG

A very naive approach would be using tr and s to remove the undesired characters, like this:

# in a loop while reading $_ =~ tr/-//d; $_ =~ s/^DL\;//o; $_ =~ s/\*$//o;

Of course, I'm unaware about any rule to remove those characters, since you didn't mentioned anything about it.

Alceu Rodrigues de Freitas Junior
---------------------------------
"You have enemies? Good. That means you've stood up for something, sometime in your life." - Sir Winston Churchill