hi there I checked with both the stuffs you have mentioned. The last one the executable('blastall') didn't cause any errors. And as you have suggested shrinking the file size din't do any good, because it results in the same error but with different line numbers. I even tried with just a single seqeuence and even that results in
CAGCGATGGGGATCAAGCTC Use of uninitialized value in pattern match (m//) at /usr/share/perl5/ +Bio/SeqIO/fasta.pm line 193, <GEN0> line 2. Use of uninitialized value in print at /usr/share/perl5/Bio/Root/IO.pm + line 407, <GEN0> line 2. -------------------- WARNING --------------------- MSG: cannot find path to blastall ---------------------------------------------------
I have also included a bit of my input sequence:
>EH0MKSX01A0000.1 CAGCGATGGGGATCAAGCTC >EH0MKSX01A006U.1 ATTTGATAAAGCCATCGGAGGCTT >EH0MKSX01A00BH.1 CAGCCGAGGGACCCACGATAC >EH0MKSX01A00O3.1 CCAGCACGTATCCGTGGACGC >EH0MKSX01A00VX.1 CGGATAGCGGGGCGGATATAGAT >EH0MKSX01A0133.1 AAGATGCGTCGAACCTTCGGGG >EH0MKSX01A01AH.1 GCGTATGAGGAGCCATGCAT >EH0MKSX01A01AK.1 AATACAAGAGTAGCTAAGTTGTCC >EH0MKSX01A01FV.1 CGATCCAATGATGCAGCCTT >EH0MKSX01A01IQ.1 CAGGAGGAGAGTTCGTCAAA >EH0MKSX01A01M9.1 AAACAGACCGCCCGCGCAGCG >EH0MKSX01A01MX.1 ATGGTGAAGGGTGGGTCATGGT >EH0MKSX01A01PQ.1 ATGATGCCGCCCAACTCGGTGA >EH0MKSX01A01SX.1 CCCATGACTGGGAGGTCGTGGT >EH0MKSX01A01WT.1 AGGGGCGGTTTGCCATGCATGC
Sorry if thats to silly but I couldn't spot it.. getting nuts of this:(
any help please, thanks,

In reply to Re^4: Aligning sequence by Anonymous Monk
in thread Aligning sequence by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.