You would probably benefit by taking a look at the following:

• Align::NW
• Simple String Alignment
• Search for identical substrings

Update: Also, XS Mechanics, which discusses the coding of Align::NW, and has some excellent resources on the Needleman-Wunsch algorithm.

hello all, here I have attached my code and the result am getting with the case of Blast

use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;
my %srna;
my %genome;
my $seqio_srna = Bio::SeqIO->new(- file=>'/home/jayakuma/script/graphi
+cs/JH_TCV_lateSL.clones.filtered.23_1_2008.fa',
                 -format=>'fasta') or die "cannot open file\n";
my $seqio_large = Bio::SeqIO->new(-file => '/home/jayakuma/script/grap
+hics/TCV-jagger.fna',
                  -format =>'fasta') or die " cannot opne the file\n";

while (my $large_seq = $seqio_large->next_seq()){
    my $id = $large_seq->display_id;
    my $seq = $large_seq->seq;
    $genome{$id} = $seq;
    
    while (my $seq_srna = $seqio_srna->next_seq()){
    my $display_id = $seq_srna->display_id;
    my $seq = $seq_srna->seq;
    $srna{$display_id} = $seq;
    #rint "seq: $seq\n";
    }
    
    foreach my $seq_id (keys %srna){
    my $srnas = $srna{$seq_id};
    print "srnas: $srnas\n";
    
    foreach($srnas){
    my $blast = Bio::Tools::Run::StandAloneBlast->new(program=>'blastn
+',database=>'/home/jayakuma/script/graphics/TCV-jagger.fna');
    my $input = Bio::Seq->new(-seq=> $srnas);
    print $input->seq, "\n";
    my $blast_report = $blast->blastall($input);
    while (my $result = $blast_report->next_result()){
        my $query_length = $result->query_length();
        while (my $hit = $result->next_hit()){
        my $id = $hit->accession();
        while (my $hsp = $hit->next_hsp()){
            if($hsp->frac_identical ==1 && $hsp ->length ==$query_leng
+th){
                print "$srnas\t$id\n";
            }
        }
        }
    }
    }
}

}
[download]

The error that am getting with this case is here;

srnas: TTTGCAGTATTGGACAAGCC
TTTGCAGTATTGGACAAGCC
Use of uninitialized value in pattern match (m//) at /usr/share/perl5/
+Bio/SeqIO/fasta.pm line 193, <GEN0> line 81643.
Use of uninitialized value in print at /usr/share/perl5/Bio/Root/IO.pm
+ line 407, <GEN0> line 81643.

-------------------- WARNING ---------------------
MSG: cannot find path to blastall
---------------------------------------------------
Can't call method "next_result" on an undefined value at aligning.pl l
+ine 34, <GEN0> line 81643.
[download]

Its dying at blastall and thus obviously couldn't get any results.
I have two files one the large file which contails 4KB(size of sequences)
And another File that contains set of small sequences (which may be around 4000 in number)
the large sequence's path is given as the database. Any help please, thanks in advance

May just be a typo but on line 6, "- file" should be "-file".

From the first error message, I'd guess that this was an input format error. Little things like spaces in the fasta ID could kill the parser. Check your input around line 81643. If this script works on a small portion of the input, try with a region around the error.

The second error message could just be an artifact because it really should know where "blastall" is kept. Just to make sure, check $blast->executable('blastall').

Can you tell us more about the problem? How is a sequence stored (a string?)? What qualifies as alignment?

for example let we have the large sequence as
ATGCGGGCCC
and the set of small sequence be
ATG
ACG
GGG
ATCCGGGCCG
then
ATGCGGGCC
ATG------
ATGCGGCC
A-G-----
abd so on....
hope this will help to know waht the alignment is,