Re^3: Aligning sequence

May just be a typo but on line 6, "- file" should be "-file".

From the first error message, I'd guess that this was an input format error. Little things like spaces in the fasta ID could kill the parser. Check your input around line 81643. If this script works on a small portion of the input, try with a region around the error.

The second error message could just be an artifact because it really should know where "blastall" is kept. Just to make sure, check $blast->executable('blastall').

Comment on Re^3: Aligning sequence Download Code

Replies are listed 'Best First'.
Re^4: Aligning sequence by Anonymous Monk on Feb 29, 2008 at 13:52 UTC
hi there I checked with both the stuffs you have mentioned. The last one the executable('blastall') didn't cause any errors. And as you have suggested shrinking the file size din't do any good, because it results in the same error but with different line numbers. I even tried with just a single seqeuence and even that results in `CAGCGATGGGGATCAAGCTC Use of uninitialized value in pattern match (m//) at /usr/share/perl5/ +Bio/SeqIO/fasta.pm line 193, <GEN0> line 2. Use of uninitialized value in print at /usr/share/perl5/Bio/Root/IO.pm + line 407, <GEN0> line 2. -------------------- WARNING --------------------- MSG: cannot find path to blastall ---------------------------------------------------` [download] I have also included a bit of my input sequence: >EH0MKSX01A0000.1 CAGCGATGGGGATCAAGCTC >EH0MKSX01A006U.1 ATTTGATAAAGCCATCGGAGGCTT >EH0MKSX01A00BH.1 CAGCCGAGGGACCCACGATAC >EH0MKSX01A00O3.1 CCAGCACGTATCCGTGGACGC >EH0MKSX01A00VX.1 CGGATAGCGGGGCGGATATAGAT >EH0MKSX01A0133.1 AAGATGCGTCGAACCTTCGGGG >EH0MKSX01A01AH.1 GCGTATGAGGAGCCATGCAT >EH0MKSX01A01AK.1 AATACAAGAGTAGCTAAGTTGTCC >EH0MKSX01A01FV.1 CGATCCAATGATGCAGCCTT >EH0MKSX01A01IQ.1 CAGGAGGAGAGTTCGTCAAA >EH0MKSX01A01M9.1 AAACAGACCGCCCGCGCAGCG >EH0MKSX01A01MX.1 ATGGTGAAGGGTGGGTCATGGT >EH0MKSX01A01PQ.1 ATGATGCCGCCCAACTCGGTGA >EH0MKSX01A01SX.1 CCCATGACTGGGAGGTCGTGGT >EH0MKSX01A01WT.1 AGGGGCGGTTTGCCATGCATGC [download] Sorry if thats to silly but I couldn't spot it.. getting nuts of this:( any help please, thanks,	[reply] [d/l] [select]
Re^5: Aligning sequence by igelkott (Priest) on Mar 01, 2008 at 11:46 UTC
I disagree. Since the script doesn't work with a single sequence, my third suggestion is most likely. An error like "`MSG: cannot find path to blastall`" seems to be the main and possibly only problem. Suggested fix: set the environmental variable $BLASTDIR or your $PATH variable to point to the BLAST directory.	[reply] [d/l]