Hello all,
I have been wrting a blast script which results in the following error:
the small rnas:CAGCGATGGGGATCAAGCTC
the sequnce thats being worked is CAGCGATGGGGATCAAGCTC
[blastall] WARNING: Unable to open TCV-jagger.fna.nin
[blastall] WARNING: : Unable to open TCV-jagger.fna.nin

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: blastall call crashed: 256 /usr/bin/blastall -p  blastn  -d  "/va
+r/common/CGI-BIN/TCV-jagger.fna"  -i  /tmp/Qs5Y9sAFLK  -o  /tmp/Rk2tt
+OzUih

STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/share/perl/5.8.8/Bio/Root/Roo
+t.pm:328
STACK: Bio::Tools::Run::StandAloneBlast::_runblast /usr/local/share/pe
+rl/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:759
STACK: Bio::Tools::Run::StandAloneBlast::_generic_local_blast /usr/loc
+al/share/perl/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:706
STACK: Bio::Tools::Run::StandAloneBlast::blastall /usr/local/share/per
+l/5.8.8/Bio/Tools/Run/StandAloneBlast.pm:557
STACK: aligning.pl:34

[download]
I have attached my code along with this: I couldn.t really get what the problem is as far as I understand there should be 'something wrong ' with the line, my $blast_report = $blast->blastall($input); but may be the $blast could n't get the file s?????
#!/usr/bin/perl -w

use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;
my %srna;
my %genome;
my $seqio_srna = Bio::SeqIO->new(-file=>'/home/jayakuma/script/graphic
+s/model2.fasta',
                 -format=>'fasta') or die "cannot open file\n";
my $seqio_large = Bio::SeqIO->new(-file => '/home/jayakuma/script/grap
+hics/TCV-jagger.fna',
                  -format =>'fasta') or die " cannot opne the file\n";

while (my $large_seq = $seqio_large->next_seq()){
    my $id = $large_seq->display_id;
    my $seq = $large_seq->seq;
    $genome{$id} = $seq;
}
while (my $seq_srna = $seqio_srna->next_seq()){
    my $display_id = $seq_srna->display_id;
    my $seq = $seq_srna->seq;
    $srna{$display_id} = $seq;
    
    }

foreach my $seq_id (keys %srna){
    my $srnas = $srna{$seq_id};
    #print "srnas: $srnas\n";
    
    foreach($srnas){
    print "the small rnas:$srnas", "\n";
    my $blast = Bio::Tools::Run::StandAloneBlast->new(program => 'blas
+tn', database => 'var/common/CGI-BIN/TCV-jagger.fna');    
    my $input = Bio::Seq->new(-seq=> $srnas);
    print "the sequnce thats being worked is ", $input->seq, "\n";
    my $blast_report = $blast->blastall($input);
    while (my $result = $blast_report->next_result()){
        my $query_length = $result->query_length();
        while (my $hit = $result->next_hit()){
        my $id = $hit->accession();
        while (my $hsp = $hit->next_hsp()){
            if($hsp->frac_identical ==1 && $hsp ->length ==$query_leng
+th){
            print "srna:$srnas\t$id\n";
            }
        }
        }
    }
    
    }
}

[download]
If any one could give a suggestion for this, that would be very helpful.
thanks

In reply to blast crashed by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.