Be aware. Bio::SeqIO is ludicrously slow! And has been known to be so for a long time.

That's the trouble with O'Woe frameworks. Everything gets buried so deep in a dark, twisty mess of unnecessary subclasses and overzealous overrides, that even when the limitations are obvious and horribly detrimental, no one can see their way through to correcting the problem.

By way of contrast, run against a 200MB, 1,058,202 140-char sequence fasta file, the following runs in just 11 seconds:

#! perl -slw use strict; use Data::Dumper; local $/ = '>'; my @sequences; (undef) = scalar <>; my $start = time; while( my $record = <> ) { my @lines = split "\n", $record; pop @lines if $lines[-1] eq '>'; my $desc = shift @lines; my $seq = join'', @lines; print $desc; } printf STDERR "Took %d seconds\n", time() - $start; __END__ c:\test>fasta test.fasta >nul Took 11 seconds c:\test>dir test.fasta 27/07/2010 22:40 201,116,583 test.fasta c:\test>tail test.fasta CGCGCCTCAGCGGGGGAGGTCCGTATGACCCCGTCCATTGATTCGAACTGCCTAGTCCCCTGGATGACAA >seq1058200: Some other descriptive text here CAGGGCGGTTCATTCGCGGACCTATGGCATCCTGGCACTCAACCGGGACTGCGACCAACAATTTTGTCAA CGCGCCTCAGCGGGGGAGGTCCGTATGACCCCGTCCATTGATTCGAACTGCCTAGTCCCCTGGATGACAA >seq1058201: Some other descriptive text here CAGGGCGGTTCATTCGCGGACCTATGGCATCCTGGCACTCAACCGGGACTGCGACCAACAATTTTGTCAA CGCGCCTCAGCGGGGGAGGTCCGTATGACCCCGTCCATTGATTCGAACTGCCTAGTCCCCTGGATGACAA >seq1058202: Some other descriptive text here CAGGGCGGTTCATTCGCGGACCTATGGCATCCTGGCACTCAACCGGGACTGCGACCAACAATTTTGTCAA CGCGCCTCAGCGGGGGAGGTCCGTATGACCCCGTCCATTGATTCGAACTGCCTAGTCCCCTGGATGACAA

As your sequences are much larger, I ran it against the 163MB, 929 sequence (ave:175k/seq) na_clones.dros.RELEASE2.5 file I have kicking around. It took a whole 7 seconds:

c:\test>fasta \dell\test\fasta\na_clones.dros.RELEASE2.5 BACH50G05 : AC011761, 108350 bases, from X:19. BACH57F14 : AC018478, 103809 bases, from 4:101. BACH59K20 : AC010840, 29516 bases, from 4:101. BACN19N21 : AC010839, 91789 bases, from 4:101. ... BACR48O22 : AC104149, 193714 bases, from X:01. BACR48O23 : AC009888, 168719 bases, from 3R:99. BACR48O24 : AC023722, 191590 bases, from X:01. BACR48P17 : AC012165, 176195 bases, from X:18. BACR49A05 : AC008194, 181438 bases, from X:18. Took 7 seconds

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
RIP an inspiration; A true Folk's Guy

In reply to Re: Bioinformatics: Slow Parsing of a Fasta File by BrowserUk
in thread Bioinformatics: Slow Parsing of a Fasta File by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.