MoniqueLT:

You're close. First, you don't need the .* at the beginning and end of the match. Next, you need to tell the regex to capture the sequence you're interested in. Finally, the captured text doesn't fall into $_, it falls into $1. Read perldoc perlre and look at the capture buffers section.

Here's a quickie example:

$ cat abc.pl 
#!/usr/bin/perl
use strict;
use warnings;

my $string = "AATCGGGTATGAAAAATTTTGCCGGCGTTTGCG";

if ($string =~ /ATGAA(.*?)TGCCG/) {
    my $sequence = $1;
    print "Found it: '$1'\n";
}
else {
    print "I don't see it!\n";
}

$ perl abc.pl
Found it: 'AAATTT'

[download]

Update: s/capture groups/capture buffers/

...roboticus

When your only tool is a hammer, all problems look like your thumb.

In reply to Re: Finding patterns by roboticus
in thread Finding patterns by MoniqueLT

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.