in reply to search and print in perl

...working on a homework... - $honesty++.

Some sample data, outlining both matching and non-matching cases, would help - IMO, your description doesn't quite cut it for me - I'm barely a proficient programmer, I'm most certainly not a geneticist e.g. in this case, is a gene represented by a single char, a sequence of chars, or both?

That being said...

1. This: 

.
.
$text = "";
while($line = <IN>)
{
    $text .= $line;
}
.
.

[download]
is more usually (and in most cases, better) written as... 
local $/; # Ensure line-ends are ignored
$text = <IN>;
.
.

[download]
2. AFAICT i.e. subject to further details being provided, your RE appears to only capture start & end delimiters.

A user level that continues to overstate my experience :-))

Replies are listed 'Best First'.
Re^2: search and print in perl
by hellworld (Novice) on Jun 01, 2009 at 12:06 UTC
    Thanks. A gene is like this: it is preceded by a string TATAAT and after this string there can be one or many strings of letters A,C,G,T . then ATG string follows them, then again random amount of A,C,G,T's follow it and the gene ends with one of the strings TAA, TGA or TAG. for example a gene is TATAATATTACAATGGATCATACAGTTAG ... our gene is the part between ATG and TAG but we also have to make sure it is preceded by a TATAAT.. I have to print out the genes in the txt file according to these rules.
[reply]
      Assuming a definition per line i.e. not split over multiple lines, then... 
      use warnings;
use strict;

local $/;

my $data = <DATA>;
while ($data =~ /TATAAT[ACGT]+ATG([ACGT]+)(:?T(:?GA|AA|AG))/cgs) {
warn $1;
}

__DATA__
TATAATATTACAATGGATCATACAGTTAG
TATAATATTACAATGGATCATACAGTTAG
TATAATATT
ACAATGGATCATACAGTTAG

      [download]
      produces: 
      $ perl tst.pl
GATCATACAGT at tst.pl line 8, <DATA> chunk 1.
GATCATACAGT at tst.pl line 8, <DATA> chunk 1.
$

      [download]
      A user level that continues to overstate my experience :-))
[reply]
[d/l]
[select]

In Section Seekers of Perl Wisdom