Re^2: search and print in perl

Thanks. A gene is like this: it is preceded by a string TATAAT and after this string there can be one or many strings of letters A,C,G,T . then ATG string follows them, then again random amount of A,C,G,T's follow it and the gene ends with one of the strings TAA, TGA or TAG. for example a gene is TATAATATTACAATGGATCATACAGTTAG ... our gene is the part between ATG and TAG but we also have to make sure it is preceded by a TATAAT.. I have to print out the genes in the txt file according to these rules.

Comment on Re^2: search and print in perl

Replies are listed 'Best First'.
Re^3: search and print in perl by Bloodnok (Vicar) on Jun 01, 2009 at 12:42 UTC
Assuming a definition per line i.e. not split over multiple lines, then... `use warnings; use strict; local $/; my $data = <DATA>; while ($data =~ /TATAAT[ACGT]+ATG([ACGT]+)(:?T(:?GA\|AA\|AG))/cgs) { warn $1; } __DATA__ TATAATATTACAATGGATCATACAGTTAG TATAATATTACAATGGATCATACAGTTAG TATAATATT ACAATGGATCATACAGTTAG` [download] produces: $ perl tst.pl GATCATACAGT at tst.pl line 8, <DATA> chunk 1. GATCATACAGT at tst.pl line 8, <DATA> chunk 1. $ [download] A user level that continues to overstate my experience :-))	[reply] [d/l] [select]

Replies are listed 'Best First'.

Re^3: search and print in perl
by Bloodnok (Vicar) on Jun 01, 2009 at 12:42 UTC

use warnings;
use strict;

local $/;

my $data = <DATA>;
while ($data =~ /TATAAT[ACGT]+ATG([ACGT]+)(:?T(:?GA|AA|AG))/cgs) {
warn $1;
}

__DATA__
TATAATATTACAATGGATCATACAGTTAG
TATAATATTACAATGGATCATACAGTTAG
TATAATATT
ACAATGGATCATACAGTTAG
[download]

$ perl tst.pl
GATCATACAGT at tst.pl line 8, <DATA> chunk 1.
GATCATACAGT at tst.pl line 8, <DATA> chunk 1.
$
[download]

A user level that continues to overstate my experience :-))

[reply]
[d/l]
[select]