converting fastaq to fasta

Anonymous Monk has asked for the wisdom of the Perl Monks concerning the following question:

Replies are listed 'Best First'.
Re: converting fastaq to fasta by BrowserUk (Patriarch) on Feb 08, 2012 at 07:03 UTC
Try `perl -nle"next if ($.-1)%4 > 1; s[^\@][>]; print" filein.FASTQ > fileout.FASTA` like this: c:\test>type filein.FASTQ @SEQ_ID1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +SEQ_ID1 !''((((+))%%%++)(%%%%).1-+''))*55CCF>>>>>>CCCCCCC65 @SEQ_ID2 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +SEQ_ID2 !''((((*+))%%%++)(%%%%).1-+''))*55CCF>>>>>>CCCCCCC65 @SEQ_ID3 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +SEQ_ID3 !''((((*+))%%%++)(%%%%).1-+''))*55CCF>>>>>>CCCCCCC65 @SEQ_ID4 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +SEQ_ID4 !''((((*+))%%%++)(%%%%).1-+''))*55CCF>>>>>>CCCCCCC65 c:\test>perl -nle"next if ($.-1)%4 > 1; s[^\@][>]; print" filein.FASTQ + > fileout.FASTA c:\test>type fileout.FASTA >SEQ_ID1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT >SEQ_ID2 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT >SEQ_ID3 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT >SEQ_ID4 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT [download] Note:Switch "s to 's if you're on nix. With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday' Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error. "Science is about questioning the status quo. Questioning authority". In the absence of evidence, opinion is indistinguishable from prejudice. The start of some sanity?	[reply] [d/l] [select]
Re^2: converting fastaq to fasta by Anonymous Monk on Feb 08, 2012 at 07:12 UTC
can u be more clear i couldnt get u	[reply]
Re^3: converting fastaq to fasta by BrowserUk (Patriarch) on Feb 08, 2012 at 07:25 UTC
can u be more clear i couldnt get u Please contact your Systems Administrator, lecturer or other responsible adult. With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday' Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error. "Science is about questioning the status quo. Questioning authority". In the absence of evidence, opinion is indistinguishable from prejudice. The start of some sanity?	[reply]
Re: converting fastaq to fasta by moritz (Cardinal) on Feb 08, 2012 at 06:04 UTC
`my@e=<read>;` exhausts the `read` filehandle, thus the `while (<1.txt>` loop (which also misses a closing paren) never runs. Perl 6 - second systems done right	[reply] [d/l] [select]
Re^2: converting fastaq to fasta by Anonymous Monk on Feb 08, 2012 at 06:29 UTC
no actually while executing i closed the while loop. if the file is like this.. `@NCYC361-11a03.q1k bases 1 to 1576 GCGTGCCCGAAAAAATGCTTTTGGAGCCGCGCGTGAAAT... +NCYC361-11a03.q1k bases 1 to 1576 !)))))**(((%%(((((((+,(((++,-` [download] and i need to convert it to.. `>GCGTGCCCGAAAAAATGCTTTTGGAGCCGCGCGTGAAAT...` [download] what should i do	[reply] [d/l] [select]