Re: converting fastaq to fasta

Try perl -nle"next if ($.-1)%4 > 1; s[^\@][>]; print" filein.FASTQ > fileout.FASTA like this:

c:\test>type filein.FASTQ
@SEQ_ID1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+SEQ_ID1
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
@SEQ_ID2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+SEQ_ID2
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
@SEQ_ID3
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+SEQ_ID3
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
@SEQ_ID4
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+SEQ_ID4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

c:\test>perl -nle"next if ($.-1)%4 > 1; s[^\@][>]; print" filein.FASTQ
+ > fileout.FASTA

c:\test>type fileout.FASTA
>SEQ_ID1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
>SEQ_ID2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
>SEQ_ID3
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
>SEQ_ID4
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
[download]

Note:Switch "s to 's if you're on *nix.

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.

"Science is about questioning the status quo. Questioning authority".

In the absence of evidence, opinion is indistinguishable from prejudice.

The start of some sanity?

Comment on Re: converting fastaq to fasta Select or Download Code

Replies are listed 'Best First'.
Re^2: converting fastaq to fasta by Anonymous Monk on Feb 08, 2012 at 07:12 UTC
can u be more clear i couldnt get u	[reply]
Re^3: converting fastaq to fasta by BrowserUk (Patriarch) on Feb 08, 2012 at 07:25 UTC
can u be more clear i couldnt get u Please contact your Systems Administrator, lecturer or other responsible adult. With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday' Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error. "Science is about questioning the status quo. Questioning authority". In the absence of evidence, opinion is indistinguishable from prejudice. The start of some sanity?	[reply]