Hi,

try something like this: 
#!/usr/bin/perl
use WWW::Mechanize;
# URL for primer3
my $url = 'http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi';
my $mech = WWW::Mechanize->new();

$mech->get($url);
$sequence='ACAGCNTCTGTTGACTCCCCTGCCAGCAAGCCCACTGGCCTGAGCACATGAAGTCCTGC
+ACCCAGTCAGGAGAAGGAGCGCTCCTGGCACCAGCAGGAGCTGGCAAAGGCTCTGGAGAGCTTAGAAAG
+GGAAAAAATGGAGCTGGAAATGAGGCTAAAGGAGCAGCAGACAGAAATGGAGGCCATCCAGGCCCAGAG
+GGAAGAAGAACGGACCCAGGCAGAGAGTGCCCTATGCCAGATGCAGCTGGAAACAGAGAAGGAGAGAGT
+ATCCCTCCTGGAGACACTGCTGCAGACGCAGAAGGAGCTAGCAGATGCCAGCCAACAACTGGACGGAAC
+TGAGGCAA';
$primernum='1';
$mech->submit_form(
        form_number => 1,
        fields      => {
            SEQUENCE    => $sequence,
            PRIMER_NUM_RETURN   => $primernum,
                       }
    );
# and so fourth...

[download]
This code is untested as I dont have internet access from a machine running perl at the moment.
The documentation for WWW::Mechanize .
Let me how that turns out.

Martin

In reply to Re: WWW::Mechanize and submit button question by marto
in thread WWW::Mechanize and submit button question by srdst13

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.