I believe you want that:

DL;H1_ENSP00000194530_chr2_202024 CCCC---GCCTTCTCGCTGCCCAGC--CCCGGGGAGGGAGG*

To became:

H1_ENSP00000194530_chr2_202024 CCCCGCCTTCTCGCTGCCCAGCCCCGGGGAGGGAGG

A very naive approach would be using tr and s to remove the undesired characters, like this:

# in a loop while reading $_ =~ tr/-//d; $_ =~ s/^DL\;//o; $_ =~ s/\*$//o;

Of course, I'm unaware about any rule to remove those characters, since you didn't mentioned anything about it.

Alceu Rodrigues de Freitas Junior
---------------------------------
"You have enemies? Good. That means you've stood up for something, sometime in your life." - Sir Winston Churchill

In reply to Re: Substitution on a sequence by glasswalk3r
in thread Substitution on a sequence by uvnew

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.