Hello,
I am a beginner in perl and need a program to identify the sequence present in between 2 given co-ordinates.
For example consider a sequence "ACGTGACGACCAGATTACCACGCTATCGACG" (i.e the data we have about a whole genome of an organism) we have to input the seq using STDIN, later should ask for the co-ordinates (here consider we enter 5 - 8, the output should be GACG) and should also print how many times it is repeated in entire genome and should also tell whether the sequence is a gene or any regulatory element.
so please provide me the code as early as possible.
In reply to Re^2: Need a code
by ww
in thread Need a code
by Pratyusha Reddy
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |